RKIP cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14582-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RKIP Reagents
CRO Services
Product recommended

All RKIP Reagents
RKIP cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
564 bp
Description
Full length Clone DNA of Human phosphatidylethanolamine binding protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RKIP cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
HCNP cDNA ORF Clone, Human;HCNPpp cDNA ORF Clone, Human;HEL-210 cDNA ORF Clone, Human;HEL-S-34 cDNA ORF Clone, Human;PBP cDNA ORF Clone, Human;PEBP cDNA ORF Clone, Human;PEBP-1 cDNA ORF Clone, Human;RKIP cDNA ORF Clone, Human
RKIP Background Information
Full Name
phosphatidylethanolamine binding protein 1

RKIP cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
RKIP cDNA ORF Clone in Cloning Vector, Canine DG70125-U

RKIP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RKIP cDNA ORF Clone in Cloning Vector, Rat RG81576-G

RKIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RKIP cDNA ORF Clone in Cloning Vector, Mouse MG51347-U
RKIP cDNA ORF Clone, Mouse, untagged MG51347-UT
RKIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51347-ACGLN
RKIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51347-ACG
RKIP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51347-ANG
RKIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51347-ACR
RKIP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51347-ANR
RKIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51347-CF
RKIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51347-NF
RKIP cDNA ORF Clone, Mouse, C-His tag MG51347-CH
RKIP cDNA ORF Clone, Mouse, N-His tag MG51347-NH
RKIP cDNA ORF Clone, Mouse, C-HA tag MG51347-CY
RKIP cDNA ORF Clone, Mouse, N-HA tag MG51347-NY
RKIP cDNA ORF Clone, Mouse, C-Myc tag MG51347-CM
RKIP cDNA ORF Clone, Mouse, N-Myc tag MG51347-NM
RKIP qPCR Primer Pairs, Mouse MP201224

RKIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RKIP cDNA ORF Clone in Cloning Vector, Human HG14582-G
RKIP cDNA ORF Clone, Human, untagged HG14582-UT
RKIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14582-ACGLN
RKIP cDNA ORF Clone, Human, C-GFPSpark® tag HG14582-ACG
RKIP cDNA ORF Clone, Human, N-GFPSpark® tag HG14582-ANG
RKIP cDNA ORF Clone, Human, C-OFPSpark® tag HG14582-ACR
RKIP cDNA ORF Clone, Human, N-OFPSpark® tag HG14582-ANR
RKIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14582-CF
RKIP cDNA ORF Clone, Human, C-His tag HG14582-CH
RKIP cDNA ORF Clone, Human, N-His tag HG14582-NH
RKIP cDNA ORF Clone, Human, C-HA tag HG14582-CY
RKIP cDNA ORF Clone, Human, N-HA tag HG14582-NY
RKIP cDNA ORF Clone, Human, C-Myc tag HG14582-CM
RKIP cDNA ORF Clone, Human, N-Myc tag HG14582-NM
RKIP qPCR Primer Pairs, Human HP103217
info info
添加购物车成功! 添加购物车失败!