PDGFRA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10556-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDGFRA Reagents
CRO Services
Product recommended

All PDGFRA Reagents
PDGFRA cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3270 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 534 C/T, 1719 A/G, 3240 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human platelet-derived growth factor receptor, alpha polypeptide with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
HindIII + NotI (6kb + 3.29kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PDGFRA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGFRA cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human CD112/Nectin-2/PVRL2 Gene Plasmid Map 5634
PDGFRA cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CD140A cDNA ORF Clone, Human;PDGFR-2 cDNA ORF Clone, Human;PDGFR2 cDNA ORF Clone, Human;RHEPDGFRA cDNA ORF Clone, Human
PDGFRA Background Information

PDGFRA, also known as CD140a, together with the structurally homolog protein PDGFRB (CD140b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
platelet-derived growth factor receptor, alpha polypeptide
References
  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.
  • PDGFRA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PDGFRA cDNA ORF Clone in Cloning Vector, Rat RG80433-G
    PDGFRA cDNA ORF Clone, Rat, untagged RG80433-UT
    PDGFRA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80433-ACG
    PDGFRA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80433-ACGLN
    PDGFRA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80433-ACR
    PDGFRA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80433-CF
    PDGFRA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80433-NF
    PDGFRA cDNA ORF Clone, Rat, C-His tag RG80433-CH
    PDGFRA cDNA ORF Clone, Rat, N-His tag RG80433-NH
    PDGFRA cDNA ORF Clone, Rat, C-HA tag RG80433-CY
    PDGFRA cDNA ORF Clone, Rat, N-HA tag RG80433-NY
    PDGFRA cDNA ORF Clone, Rat, C-Myc tag RG80433-CM
    PDGFRA cDNA ORF Clone, Rat, N-Myc tag RG80433-NM
    PDGFRA qPCR Primer Pairs, Rat RP300406

    PDGFRA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDGFRA cDNA ORF Clone in Cloning Vector, Human HG10556-M
    PDGFRA cDNA ORF Clone, Human, untagged HG10556-UT
    PDGFRA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10556-ACGLN
    PDGFRA cDNA ORF Clone, Human, C-GFPSpark® tag HG10556-ACG
    PDGFRA cDNA ORF Clone, Human, C-OFPSpark® tag HG10556-ACR
    PDGFRA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10556-CF
    PDGFRA cDNA ORF Clone, Human, C-His tag HG10556-CH
    PDGFRA cDNA ORF Clone, Human, N-His tag HG10556-NH
    PDGFRA cDNA ORF Clone, Human, C-HA tag HG10556-CY
    PDGFRA cDNA ORF Clone, Human, N-HA tag HG10556-NY
    PDGFRA cDNA ORF Clone, Human, C-Myc tag HG10556-CM
    PDGFRA cDNA ORF Clone, Human, N-Myc tag HG10556-NM
    PDGFRA qPCR Primer Pairs, Human HP100568
    info info
    添加购物车成功! 添加购物车失败!