PDGF-B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10572-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDGF-B Reagents
CRO Services
Product recommended

All PDGF-B Reagents
PDGF-B cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
726 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.75kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PDGF-B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGF-B cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Human PDGF-B/PDGF-2 Gene Expression validated Image 16368
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
PDGF-B cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
c-sis cDNA ORF Clone, Human;IBGC5 cDNA ORF Clone, Human;PDGF-2 cDNA ORF Clone, Human;PDGF2 cDNA ORF Clone, Human;SIS cDNA ORF Clone, Human;SSV cDNA ORF Clone, Human
PDGF-B Background Information
Full Name
platelet-derived growth factor beta polypeptide

PDGF-B cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PDGF-B cDNA ORF Clone in Cloning Vector, Rhesus CG90030-G
PDGF-B cDNA ORF Clone, Rhesus, untagged CG90030-UT
PDGF-B Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90030-ACGLN
PDGF-B cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90030-ACG
PDGF-B cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90030-ACR
PDGF-B cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90030-CF
PDGF-B cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90030-NF
PDGF-B cDNA ORF Clone, Rhesus, C-His tag CG90030-CH
PDGF-B cDNA ORF Clone, Rhesus, N-His tag CG90030-NH
PDGF-B cDNA ORF Clone, Rhesus, C-HA tag CG90030-CY
PDGF-B cDNA ORF Clone, Rhesus, N-HA tag CG90030-NY
PDGF-B cDNA ORF Clone, Rhesus, C-Myc tag CG90030-CM
PDGF-B cDNA ORF Clone, Rhesus, N-Myc tag CG90030-NM

PDGF-B cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PDGF-B cDNA ORF Clone in Cloning Vector, Canine DG70053-G
PDGF-B cDNA ORF Clone, Canine, untagged DG70053-UT
PDGF-B Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70053-ACGLN
PDGF-B cDNA ORF Clone, Canine, C-GFPSpark® tag DG70053-ACG
PDGF-B cDNA ORF Clone, Canine, C-OFPSpark® tag DG70053-ACR
PDGF-B cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70053-CF
PDGF-B cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70053-NF
PDGF-B cDNA ORF Clone, Canine, C-His tag DG70053-CH
PDGF-B cDNA ORF Clone, Canine, N-His tag DG70053-NH
PDGF-B cDNA ORF Clone, Canine, C-HA tag DG70053-CY
PDGF-B cDNA ORF Clone, Canine, N-HA tag DG70053-NY
PDGF-B cDNA ORF Clone, Canine, C-Myc tag DG70053-CM
PDGF-B cDNA ORF Clone, Canine, N-Myc tag DG70053-NM

PDGF-B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDGF-B cDNA ORF Clone in Cloning Vector, Rat RG80053-M
PDGF-B cDNA ORF Clone, Rat, untagged RG80053-UT
PDGF-B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80053-ACG
PDGF-B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80053-ACGLN
PDGF-B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80053-ACR
PDGF-B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80053-CF
PDGF-B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80053-NF
PDGF-B cDNA ORF Clone, Rat, C-His tag RG80053-CH
PDGF-B cDNA ORF Clone, Rat, N-His tag RG80053-NH
PDGF-B cDNA ORF Clone, Rat, C-HA tag RG80053-CY
PDGF-B cDNA ORF Clone, Rat, N-HA tag RG80053-NY
PDGF-B cDNA ORF Clone, Rat, C-Myc tag RG80053-CM
PDGF-B cDNA ORF Clone, Rat, N-Myc tag RG80053-NM
PDGF-B qPCR Primer Pairs, Rat RP300051

PDGF-B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDGF-B cDNA ORF Clone in Cloning Vector, Mouse MG50801-G
PDGF-B cDNA ORF Clone, Mouse, untagged MG50801-UT
PDGF-B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50801-ACG
PDGF-B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50801-ACGLN
PDGF-B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50801-ACR
PDGF-B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50801-CF
PDGF-B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50801-NF
PDGF-B cDNA ORF Clone, Mouse, C-His tag MG50801-CH
PDGF-B cDNA ORF Clone, Mouse, N-His tag MG50801-NH
PDGF-B cDNA ORF Clone, Mouse, C-HA tag MG50801-CY
PDGF-B cDNA ORF Clone, Mouse, N-HA tag MG50801-NY
PDGF-B cDNA ORF Clone, Mouse, C-Myc tag MG50801-CM
PDGF-B cDNA ORF Clone, Mouse, N-Myc tag MG50801-NM
PDGF-B qPCR Primer Pairs, Mouse MP200772

PDGF-B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDGF-B cDNA ORF Clone in Cloning Vector, Human HG10572-M
PDGF-B cDNA ORF Clone, Human, untagged HG10572-UT
PDGF-B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10572-ACGLN
PDGF-B cDNA ORF Clone, Human, C-GFPSpark® tag HG10572-ACG
PDGF-B cDNA ORF Clone, Human, C-OFPSpark® tag HG10572-ACR
PDGF-B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10572-CF
PDGF-B cDNA ORF Clone, Human, C-His tag HG10572-CH
PDGF-B cDNA ORF Clone, Human, N-His tag HG10572-NH
PDGF-B cDNA ORF Clone, Human, C-HA tag HG10572-CY
PDGF-B cDNA ORF Clone, Human, N-HA tag HG10572-NY
PDGF-B cDNA ORF Clone, Human, C-Myc tag HG10572-CM
PDGF-B cDNA ORF Clone, Human, N-Myc tag HG10572-NM
PDGF-B qPCR Primer Pairs, Human HP100579
info info
添加购物车成功! 添加购物车失败!