PC/pyruvate carboxylase cDNA ORF Clone, Human, C-Myc tag

Cat: HG15615-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PC/pyruvate carboxylase Reagents
CRO Services
Product recommended

All PC/pyruvate carboxylase Reagents
PC/pyruvate carboxylase cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3582 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human pyruvate carboxylase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI(6kb+3.58kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PC/pyruvate carboxylase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PC/pyruvate carboxylase cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
PC/pyruvate carboxylase cDNA ORF Clone, Human, C-Myc tag Alternative Names
PCB cDNA ORF Clone, Human
PC/pyruvate carboxylase Background Information
Full Name
pyruvate carboxylase

PC/pyruvate carboxylase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PC/pyruvate carboxylase cDNA ORF Clone in Cloning Vector, Rat RG81674-G
PC/pyruvate carboxylase cDNA ORF Clone, Rat, untagged RG81674-UT
PC/pyruvate carboxylase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81674-ACGLN
PC/pyruvate carboxylase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81674-ACG
PC/pyruvate carboxylase cDNA ORF Clone, Rat, N-GFPSpark® tag RG81674-ANG
PC/pyruvate carboxylase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81674-ACR
PC/pyruvate carboxylase cDNA ORF Clone, Rat, N-OFPSpark® tag RG81674-ANR
PC/pyruvate carboxylase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81674-CF
PC/pyruvate carboxylase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81674-NF
PC/pyruvate carboxylase cDNA ORF Clone, Rat, C-His tag RG81674-CH
PC/pyruvate carboxylase cDNA ORF Clone, Rat, N-His tag RG81674-NH
PC/pyruvate carboxylase cDNA ORF Clone, Rat, C-HA tag RG81674-CY
PC/pyruvate carboxylase cDNA ORF Clone, Rat, N-HA tag RG81674-NY
PC/pyruvate carboxylase cDNA ORF Clone, Rat, C-Myc tag RG81674-CM
PC/pyruvate carboxylase cDNA ORF Clone, Rat, N-Myc tag RG81674-NM

PC/pyruvate carboxylase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PC/pyruvate carboxylase cDNA ORF Clone in Cloning Vector, Human HG15615-G
PC/pyruvate carboxylase cDNA ORF Clone, Human, untagged HG15615-UT
PC/pyruvate carboxylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15615-ACGLN
PC/pyruvate carboxylase cDNA ORF Clone, Human, C-GFPSpark® tag HG15615-ACG
PC/pyruvate carboxylase cDNA ORF Clone, Human, N-GFPSpark® tag HG15615-ANG
PC/pyruvate carboxylase cDNA ORF Clone, Human, C-OFPSpark® tag HG15615-ACR
PC/pyruvate carboxylase cDNA ORF Clone, Human, N-OFPSpark® tag HG15615-ANR
PC/pyruvate carboxylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15615-CF
PC/pyruvate carboxylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15615-NF
PC/pyruvate carboxylase cDNA ORF Clone, Human, C-His tag HG15615-CH
PC/pyruvate carboxylase cDNA ORF Clone, Human, N-His tag HG15615-NH
PC/pyruvate carboxylase cDNA ORF Clone, Human, C-HA tag HG15615-CY
PC/pyruvate carboxylase cDNA ORF Clone, Human, N-HA tag HG15615-NY
PC/pyruvate carboxylase cDNA ORF Clone, Human, N-Myc tag HG15615-NM
PC/pyruvate carboxylase qPCR Primer Pairs, Human HP104234
info info
添加购物车成功! 添加购物车失败!