PACSIN3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15616-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PACSIN3 Reagents
CRO Services
Product recommended

All PACSIN3 Reagents
PACSIN3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Human protein kinase C and casein kinase substrate in neurons 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PACSIN3 cDNA ORF Clone, Human, C-Myc tag Alternative Names
SDPIII cDNA ORF Clone, Human
PACSIN3 Background Information
Full Name
protein kinase C and casein kinase substrate in neurons 3

PACSIN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PACSIN3 cDNA ORF Clone in Cloning Vector, Mouse MG51205-U
PACSIN3 cDNA ORF Clone, Mouse, untagged MG51205-UT
PACSIN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51205-ACGLN
PACSIN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51205-ACG
PACSIN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51205-ANG
PACSIN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51205-ACR
PACSIN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51205-ANR
PACSIN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51205-CF
PACSIN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51205-NF
PACSIN3 cDNA ORF Clone, Mouse, C-His tag MG51205-CH
PACSIN3 cDNA ORF Clone, Mouse, N-His tag MG51205-NH
PACSIN3 cDNA ORF Clone, Mouse, C-HA tag MG51205-CY
PACSIN3 cDNA ORF Clone, Mouse, N-HA tag MG51205-NY
PACSIN3 cDNA ORF Clone, Mouse, C-Myc tag MG51205-CM
PACSIN3 cDNA ORF Clone, Mouse, N-Myc tag MG51205-NM
PACSIN3 qPCR Primer Pairs, Mouse MP201089

PACSIN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PACSIN3 cDNA ORF Clone in Cloning Vector, Human HG15616-G
PACSIN3 cDNA ORF Clone, Human, untagged HG15616-UT
PACSIN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15616-ACG
PACSIN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15616-ACGLN
PACSIN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15616-ACR
PACSIN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15616-CF
PACSIN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15616-NF
PACSIN3 cDNA ORF Clone, Human, C-His tag HG15616-CH
PACSIN3 cDNA ORF Clone, Human, N-His tag HG15616-NH
PACSIN3 cDNA ORF Clone, Human, C-HA tag HG15616-CY
PACSIN3 cDNA ORF Clone, Human, N-HA tag HG15616-NY
PACSIN3 cDNA ORF Clone, Human, N-Myc tag HG15616-NM
PACSIN3 qPCR Primer Pairs, Human HP104235
info info
添加购物车成功! 添加购物车失败!