P2RX1 cDNA ORF Clone, Human, C-His tag

Cat: HG15175-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All P2RX1 Reagents
CRO Services
Product recommended

All P2RX1 Reagents
P2RX1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1200 bp
Description
Full length Clone DNA of Human purinergic receptor P2X, ligand-gated ion channel, 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

P2RX1 cDNA ORF Clone, Human, C-His tag Alternative Names
P2X1 cDNA ORF Clone, Human
P2RX1 Background Information
Full Name
purinergic receptor P2X, ligand gated ion channel, 1

P2RX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
P2RX1 cDNA ORF Clone in Cloning Vector, Mouse MG53096-G
P2RX1 cDNA ORF Clone, Mouse, untagged MG53096-UT
P2RX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53096-ACGLN
P2RX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53096-ACG
P2RX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53096-ACR
P2RX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53096-CF
P2RX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53096-NF
P2RX1 cDNA ORF Clone, Mouse, C-His tag MG53096-CH
P2RX1 cDNA ORF Clone, Mouse, N-His tag MG53096-NH
P2RX1 cDNA ORF Clone, Mouse, C-HA tag MG53096-CY
P2RX1 cDNA ORF Clone, Mouse, N-HA tag MG53096-NY
P2RX1 cDNA ORF Clone, Mouse, C-Myc tag MG53096-CM
P2RX1 cDNA ORF Clone, Mouse, N-Myc tag MG53096-NM

P2RX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
P2RX1 cDNA ORF Clone in Cloning Vector, Human HG15175-G
P2RX1 cDNA ORF Clone, Human, untagged HG15175-UT
P2RX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15175-ACGLN
P2RX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15175-ACG
P2RX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15175-ACR
P2RX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15175-CF
P2RX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15175-NF
P2RX1 cDNA ORF Clone, Human, N-His tag HG15175-NH
P2RX1 cDNA ORF Clone, Human, C-HA tag HG15175-CY
P2RX1 cDNA ORF Clone, Human, N-HA tag HG15175-NY
P2RX1 cDNA ORF Clone, Human, C-Myc tag HG15175-CM
P2RX1 cDNA ORF Clone, Human, N-Myc tag HG15175-NM
P2RX1 qPCR Primer Pairs, Human HP103802
info info
添加购物车成功! 添加购物车失败!