NRBP1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10790-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NRBP1 Reagents

CRO Services

Product recommended


All NRBP1 Reagents

NRBP1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1608 bp
Description
Full length Clone DNA of Human nuclear receptor binding protein 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NRBP1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

BCON3 cDNA ORF Clone, Human;MADM cDNA ORF Clone, Human;MUDPNP cDNA ORF Clone, Human;NRBP cDNA ORF Clone, Human

NRBP1 Background Information

Full Name
nuclear receptor binding protein 1

NRBP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NRBP1 cDNA ORF Clone in Cloning Vector, Rat RG8A4554-U
NRBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4554-ACGLN

NRBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NRBP1 cDNA ORF Clone in Cloning Vector, Mouse MG51024-G
NRBP1 cDNA ORF Clone, Mouse, untagged MG51024-UT
NRBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51024-ACGLN
NRBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51024-ACG
NRBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51024-ANG
NRBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51024-ACR
NRBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51024-ANR
NRBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51024-CF
NRBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51024-NF
NRBP1 cDNA ORF Clone, Mouse, C-His tag MG51024-CH
NRBP1 cDNA ORF Clone, Mouse, N-His tag MG51024-NH
NRBP1 cDNA ORF Clone, Mouse, C-HA tag MG51024-CY
NRBP1 cDNA ORF Clone, Mouse, N-HA tag MG51024-NY
NRBP1 cDNA ORF Clone, Mouse, C-Myc tag MG51024-CM
NRBP1 cDNA ORF Clone, Mouse, N-Myc tag MG51024-NM
NRBP1 qPCR Primer Pairs, Mouse MP200983

NRBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NRBP1 cDNA ORF Clone in Cloning Vector, Human HG10790-M
NRBP1 cDNA ORF Clone, Human, untagged HG10790-UT
NRBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10790-ACG
NRBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10790-ACGLN
NRBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10790-ANG
NRBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10790-ACR
NRBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10790-ANR
NRBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10790-CF
NRBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10790-NF
NRBP1 cDNA ORF Clone, Human, C-His tag HG10790-CH
NRBP1 cDNA ORF Clone, Human, N-His tag HG10790-NH
NRBP1 cDNA ORF Clone, Human, C-HA tag HG10790-CY
NRBP1 cDNA ORF Clone, Human, N-HA tag HG10790-NY
NRBP1 cDNA ORF Clone, Human, C-Myc tag HG10790-CM
NRBP1 qPCR Primer Pairs, Human HP100704
info info
添加购物车成功! 添加购物车失败!