NR1H2/LXR beta cDNA ORF Clone, Human, C-HA tag

Cat: HG16388-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NR1H2/LXR beta Reagents
CRO Services
Product recommended

All NR1H2/LXR beta Reagents
NR1H2/LXR beta cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Description
Full length Clone DNA of Human nuclear receptor subfamily 1, group H, member 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NR1H2/LXR beta cDNA ORF Clone, Human, C-HA tag Alternative Names
LXR-b cDNA ORF Clone, Human;LXRB cDNA ORF Clone, Human;NER cDNA ORF Clone, Human;NER-I cDNA ORF Clone, Human;RIP15 cDNA ORF Clone, Human;UNR cDNA ORF Clone, Human
NR1H2/LXR beta Background Information
Full Name
nuclear receptor subfamily 1, group H, member 2

NR1H2/LXR beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NR1H2/LXR beta cDNA ORF Clone in Cloning Vector, Mouse MG51522-U
NR1H2/LXR beta cDNA ORF Clone, Mouse, untagged MG51522-UT
NR1H2/LXR beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51522-ACGLN
NR1H2/LXR beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51522-ACG
NR1H2/LXR beta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51522-ANG
NR1H2/LXR beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51522-ACR
NR1H2/LXR beta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51522-ANR
NR1H2/LXR beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51522-CF
NR1H2/LXR beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51522-NF
NR1H2/LXR beta cDNA ORF Clone, Mouse, C-His tag MG51522-CH
NR1H2/LXR beta cDNA ORF Clone, Mouse, N-His tag MG51522-NH
NR1H2/LXR beta cDNA ORF Clone, Mouse, C-HA tag MG51522-CY
NR1H2/LXR beta cDNA ORF Clone, Mouse, N-HA tag MG51522-NY
NR1H2/LXR beta cDNA ORF Clone, Mouse, C-Myc tag MG51522-CM
NR1H2/LXR beta cDNA ORF Clone, Mouse, N-Myc tag MG51522-NM
NR1H2/LXR beta qPCR Primer Pairs, Mouse MP201406

NR1H2/LXR beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NR1H2/LXR beta cDNA ORF Clone in Cloning Vector, Human HG16388-G
NR1H2/LXR beta cDNA ORF Clone, Human, untagged HG16388-UT
NR1H2/LXR beta cDNA ORF Clone, Human, C-GFPSpark® tag HG16388-ACG
NR1H2/LXR beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16388-ACGLN
NR1H2/LXR beta cDNA ORF Clone, Human, N-GFPSpark® tag HG16388-ANG
NR1H2/LXR beta cDNA ORF Clone, Human, C-OFPSpark® tag HG16388-ACR
NR1H2/LXR beta cDNA ORF Clone, Human, N-OFPSpark® tag HG16388-ANR
NR1H2/LXR beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16388-CF
NR1H2/LXR beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16388-NF
NR1H2/LXR beta cDNA ORF Clone, Human, C-His tag HG16388-CH
NR1H2/LXR beta cDNA ORF Clone, Human, N-His tag HG16388-NH
NR1H2/LXR beta cDNA ORF Clone, Human, N-HA tag HG16388-NY
NR1H2/LXR beta cDNA ORF Clone, Human, C-Myc tag HG16388-CM
NR1H2/LXR beta cDNA ORF Clone, Human, N-Myc tag HG16388-NM
NR1H2/LXR beta qPCR Primer Pairs, Human HP105137
info info
添加购物车成功! 添加购物车失败!