NOSTRIN cDNA ORF Clone, Human, N-His tag

Cat: HG14269-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NOSTRIN Reagents
CRO Services
Product recommended

All NOSTRIN Reagents
NOSTRIN cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1287 bp
Description
Full length Clone DNA of Human nitric oxide synthase trafficker with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NOSTRIN cDNA ORF Clone, Human, N-His tag Alternative Names
DaIP2 cDNA ORF Clone, Human
NOSTRIN Background Information
Full Name
nitric oxide synthase trafficking

NOSTRIN cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NOSTRIN cDNA ORF Clone in Cloning Vector, Rat RG80997-U
NOSTRIN cDNA ORF Clone, Rat, untagged RG80997-UT
NOSTRIN cDNA ORF Clone, Rat, C-GFPSpark® tag RG80997-ACG
NOSTRIN Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80997-ACGLN
NOSTRIN cDNA ORF Clone, Rat, C-OFPSpark® tag RG80997-ACR
NOSTRIN cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80997-CF
NOSTRIN cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80997-NF
NOSTRIN cDNA ORF Clone, Rat, C-His tag RG80997-CH
NOSTRIN cDNA ORF Clone, Rat, N-His tag RG80997-NH
NOSTRIN cDNA ORF Clone, Rat, C-HA tag RG80997-CY
NOSTRIN cDNA ORF Clone, Rat, N-HA tag RG80997-NY
NOSTRIN cDNA ORF Clone, Rat, C-Myc tag RG80997-CM
NOSTRIN cDNA ORF Clone, Rat, N-Myc tag RG80997-NM
NOSTRIN qPCR Primer Pairs, Rat RP300961

NOSTRIN cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NOSTRIN cDNA ORF Clone in Cloning Vector, Human HG14269-G
NOSTRIN cDNA ORF Clone, Human, untagged HG14269-UT
NOSTRIN cDNA ORF Clone, Human, C-GFPSpark® tag HG14269-ACG
NOSTRIN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14269-ACGLN
NOSTRIN cDNA ORF Clone, Human, N-GFPSpark® tag HG14269-ANG
NOSTRIN cDNA ORF Clone, Human, C-OFPSpark® tag HG14269-ACR
NOSTRIN cDNA ORF Clone, Human, N-OFPSpark® tag HG14269-ANR
NOSTRIN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14269-CF
NOSTRIN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14269-NF
NOSTRIN cDNA ORF Clone, Human, C-His tag HG14269-CH
NOSTRIN cDNA ORF Clone, Human, C-HA tag HG14269-CY
NOSTRIN cDNA ORF Clone, Human, N-HA tag HG14269-NY
NOSTRIN cDNA ORF Clone, Human, C-Myc tag HG14269-CM
NOSTRIN cDNA ORF Clone, Human, N-Myc tag HG14269-NM
NOSTRIN qPCR Primer Pairs, Human HP102919
info info
添加购物车成功! 添加购物车失败!