NEDD8 cDNA ORF Clone, Human, C-Myc tag

Cat: HG15620-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NEDD8 Reagents
CRO Services
Product recommended

All NEDD8 Reagents
NEDD8 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
246 bp
Description
Full length Clone DNA of Human neural precursor cell expressed, developmentally down-regulated 8 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEDD8 cDNA ORF Clone, Human, C-Myc tag Alternative Names
NEDD-8 cDNA ORF Clone, Human
NEDD8 Background Information
Full Name
neural precursor cell expressed, developmentally down-regulated 8

NEDD8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NEDD8 cDNA ORF Clone in Cloning Vector, Mouse MG53287-U
NEDD8 cDNA ORF Clone, Mouse, untagged MG53287-UT
NEDD8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53287-ACGLN
NEDD8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53287-ACG
NEDD8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53287-ANG
NEDD8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53287-ACR
NEDD8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53287-ANR
NEDD8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53287-CF
NEDD8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53287-NF
NEDD8 cDNA ORF Clone, Mouse, C-His tag MG53287-CH
NEDD8 cDNA ORF Clone, Mouse, N-His tag MG53287-NH
NEDD8 cDNA ORF Clone, Mouse, C-HA tag MG53287-CY
NEDD8 cDNA ORF Clone, Mouse, N-HA tag MG53287-NY
NEDD8 cDNA ORF Clone, Mouse, C-Myc tag MG53287-CM
NEDD8 cDNA ORF Clone, Mouse, N-Myc tag MG53287-NM

NEDD8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NEDD8 cDNA ORF Clone in Cloning Vector, Human HG15620-G
NEDD8 cDNA ORF Clone, Human, untagged HG15620-UT
NEDD8 cDNA ORF Clone, Human, C-GFPSpark® tag HG15620-ACG
NEDD8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15620-ACGLN
NEDD8 cDNA ORF Clone, Human, N-GFPSpark® tag HG15620-ANG
NEDD8 cDNA ORF Clone, Human, C-OFPSpark® tag HG15620-ACR
NEDD8 cDNA ORF Clone, Human, N-OFPSpark® tag HG15620-ANR
NEDD8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15620-CF
NEDD8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15620-NF
NEDD8 cDNA ORF Clone, Human, C-His tag HG15620-CH
NEDD8 cDNA ORF Clone, Human, N-His tag HG15620-NH
NEDD8 cDNA ORF Clone, Human, C-HA tag HG15620-CY
NEDD8 cDNA ORF Clone, Human, N-HA tag HG15620-NY
NEDD8 cDNA ORF Clone, Human, N-Myc tag HG15620-NM
NEDD8 qPCR Primer Pairs, Human HP104238
info info
添加购物车成功! 添加购物车失败!