MOCS2 cDNA ORF Clone, Human, N-His tag

Cat: HG15983-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MOCS2 Reagents
CRO Services
Product recommended

All MOCS2 Reagents
MOCS2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
567 bp
Description
Full length Clone DNA of Human molybdenum cofactor synthesis 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MOCS2 cDNA ORF Clone, Human, N-His tag Alternative Names
MCBPE cDNA ORF Clone, Human;MOCO1 cDNA ORF Clone, Human;MOCODB cDNA ORF Clone, Human;MPTS cDNA ORF Clone, Human
MOCS2 Background Information
Full Name
molybdenum cofactor synthesis 2

MOCS2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MOCS2 cDNA ORF Clone in Cloning Vector, Mouse MG53382-U
MOCS2 cDNA ORF Clone, Mouse, untagged MG53382-UT
MOCS2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53382-ACGLN
MOCS2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53382-ACG
MOCS2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53382-ANG
MOCS2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53382-ACR
MOCS2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53382-ANR
MOCS2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53382-CF
MOCS2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53382-NF
MOCS2 cDNA ORF Clone, Mouse, C-His tag MG53382-CH
MOCS2 cDNA ORF Clone, Mouse, N-His tag MG53382-NH
MOCS2 cDNA ORF Clone, Mouse, C-HA tag MG53382-CY
MOCS2 cDNA ORF Clone, Mouse, N-HA tag MG53382-NY
MOCS2 cDNA ORF Clone, Mouse, C-Myc tag MG53382-CM
MOCS2 cDNA ORF Clone, Mouse, N-Myc tag MG53382-NM

MOCS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MOCS2 cDNA ORF Clone in Cloning Vector, Human HG15983-G
MOCS2 cDNA ORF Clone, Human, untagged HG15983-UT
MOCS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15983-ACG
MOCS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15983-ACGLN
MOCS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15983-ANG
MOCS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15983-ACR
MOCS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15983-ANR
MOCS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15983-CF
MOCS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15983-NF
MOCS2 cDNA ORF Clone, Human, C-His tag HG15983-CH
MOCS2 cDNA ORF Clone, Human, C-HA tag HG15983-CY
MOCS2 cDNA ORF Clone, Human, N-HA tag HG15983-NY
MOCS2 cDNA ORF Clone, Human, C-Myc tag HG15983-CM
MOCS2 cDNA ORF Clone, Human, N-Myc tag HG15983-NM
MOCS2 qPCR Primer Pairs, Human HP104570
info info
添加购物车成功! 添加购物车失败!