METRN cDNA ORF Clone, Human, N-HA tag

Cat: HG13433-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All METRN Reagents

CRO Services

Product recommended


All METRN Reagents

METRN cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
882 bp
Description
Full length Clone DNA of Human meteorin, glial cell differentiation regulator with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METRN cDNA ORF Clone, Human, N-HA tag Alternative Names

C16orf23 cDNA ORF Clone, Human;c380A1.2 cDNA ORF Clone, Human

METRN Background Information

Meteorin is a novel secreted protein that is expressed in undifferentiated neural progenitors and in the astrocyte lineage, including radial glia. It plays important roles in the differentiation of glial cells and also in axonal network formation during neurogenesis. Meteorin selectively promoted astrocyte formation from mouse cerebrocortical neurospheres in differentiation culture, whereas it induced cerebellar astrocytes to become radial glia. Meteorin also induced axonal extension in small and intermediate neurons of sensory ganglia by activating nearby satellite glia.

Full Name
meteorin, glial cell differentiation regulator
References
  • Martin J, et al. (2004) The sequence and analysis of duplication-rich human chromosome 16. Nature. 432(7020):988-94.
  • Nishino J, et al. (2004) Meteorin: a secreted protein that regulates glial cell differentiation and promotes axonal extension. EMBO J. 23(9):1998-2008.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • METRN cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    METRN cDNA ORF Clone in Cloning Vector, Mouse MG50605-M
    METRN cDNA ORF Clone, Mouse, untagged MG50605-UT
    METRN cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50605-ACG
    METRN Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50605-ACGLN
    METRN cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50605-ACR
    METRN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50605-CF
    METRN cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50605-NF
    METRN cDNA ORF Clone, Mouse, C-His tag MG50605-CH
    METRN cDNA ORF Clone, Mouse, N-His tag MG50605-NH
    METRN cDNA ORF Clone, Mouse, C-HA tag MG50605-CY
    METRN cDNA ORF Clone, Mouse, N-HA tag MG50605-NY
    METRN cDNA ORF Clone, Mouse, C-Myc tag MG50605-CM
    METRN cDNA ORF Clone, Mouse, N-Myc tag MG50605-NM
    METRN qPCR Primer Pairs, Mouse MP200591

    METRN cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    METRN cDNA ORF Clone in Cloning Vector, Human HG13433-G
    METRN cDNA ORF Clone, Human, untagged HG13433-UT
    METRN cDNA ORF Clone, Human, C-GFPSpark® tag HG13433-ACG
    METRN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13433-ACGLN
    METRN cDNA ORF Clone, Human, C-OFPSpark® tag HG13433-ACR
    METRN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13433-CF
    METRN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13433-NF
    METRN cDNA ORF Clone, Human, C-His tag HG13433-CH
    METRN cDNA ORF Clone, Human, N-His tag HG13433-NH
    METRN cDNA ORF Clone, Human, C-HA tag HG13433-CY
    METRN cDNA ORF Clone, Human, C-Myc tag HG13433-CM
    METRN cDNA ORF Clone, Human, N-Myc tag HG13433-NM
    METRN qPCR Primer Pairs, Human HP102135
    info info
    添加购物车成功! 添加购物车失败!