MEK1 cDNA ORF Clone, Human, untagged

Cat: HG10661-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MEK1 Reagents
CRO Services
Product recommended

All MEK1 Reagents
MEK1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+1.18kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MEK1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MEK1 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
MEK1 cDNA ORF Clone, Human, untagged Alternative Names
CFC3 cDNA ORF Clone, Human;MAPKK1 cDNA ORF Clone, Human;MEK1 cDNA ORF Clone, Human;MKK1 cDNA ORF Clone, Human;PRKMK1 cDNA ORF Clone, Human
MEK1 Background Information

MEK1, also known as MAP2K1 and MKK1, is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. MEK1 is widely expressed, with extremely low levels in brain. It lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, MEK1 is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. Binding extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1 and MEK2. MEK1 has been shown to export PPARG from the nucleus. The MAPK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis. MKK1 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. Defects in MEK1 can cause cardiofaciocutaneous syndrome.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
mitogen-activated protein kinase kinase 1
References
  • Rampoldi L, et al. (1998) Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet Cell Genet. 78(3-4):301-3.
  • Zheng CF, et al. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. 268(15):11435-9.
  • Nantel, et al. (1998) Interaction of the Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem. 273(17):10475-84.
  • Hirata H, et al. (2012) I MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer. Carcinogenesis. 33(1):41-8.
  • MEK1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    MEK1 cDNA ORF Clone in Cloning Vector, Rat RG81948-U
    MEK1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81948-ACGLN

    MEK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MEK1 cDNA ORF Clone in Cloning Vector, Mouse MG50312-M
    MEK1 cDNA ORF Clone, Mouse, untagged MG50312-UT
    MEK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50312-ACG
    MEK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50312-ACGLN
    MEK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50312-ANG
    MEK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50312-ACR
    MEK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50312-ANR
    MEK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50312-CF
    MEK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50312-NF
    MEK1 cDNA ORF Clone, Mouse, C-His tag MG50312-CH
    MEK1 cDNA ORF Clone, Mouse, N-His tag MG50312-NH
    MEK1 cDNA ORF Clone, Mouse, C-HA tag MG50312-CY
    MEK1 cDNA ORF Clone, Mouse, N-HA tag MG50312-NY
    MEK1 cDNA ORF Clone, Mouse, C-Myc tag MG50312-CM
    MEK1 cDNA ORF Clone, Mouse, N-Myc tag MG50312-NM
    MEK1 qPCR Primer Pairs, Mouse MP200335

    MEK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MEK1 cDNA ORF Clone in Cloning Vector, Human HG10661-M
    MEK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10661-ACGLN
    MEK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10661-ACG
    MEK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10661-ANG
    MEK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10661-ACR
    MEK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10661-ANR
    MEK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10661-CF
    MEK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10661-NF
    MEK1 cDNA ORF Clone, Human, C-His tag HG10661-CH
    MEK1 cDNA ORF Clone, Human, N-His tag HG10661-NH
    MEK1 cDNA ORF Clone, Human, C-HA tag HG10661-CY
    MEK1 cDNA ORF Clone, Human, N-HA tag HG10661-NY
    MEK1 cDNA ORF Clone, Human, C-Myc tag HG10661-CM
    MEK1 cDNA ORF Clone, Human, N-Myc tag HG10661-NM
    MEK1 qPCR Primer Pairs, Human HP100873
    info info
    添加购物车成功! 添加购物车失败!