SAPK4 cDNA ORF Clone, Human, N-His tag

Cat: HG10747-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SAPK4 Reagents
CRO Services
Product recommended

All SAPK4 Reagents
SAPK4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1098 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase 13 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SAPK4 cDNA ORF Clone, Human, N-His tag Alternative Names
MAPK-13 cDNA ORF Clone, Human;MAPK13 cDNA ORF Clone, Human;p38delta cDNA ORF Clone, Human;PRKM13 cDNA ORF Clone, Human;SAPK4 cDNA ORF Clone, Human
SAPK4 Background Information

The p38 family of mitogen-activated protein kinases (MAPK) includes p38 alpha (SAPK2a, CSBP), p38 beta (SAPK2b), p38 delta (SAPK4), and p38 gamma (SAPK3/ERK6). p38 alpha and p38 beta are widely expressed p38 isoforms that are involved in regulation of cell proliferation, differentiation, development, and response to stress. p38 delta, also known as MAPK13, is a regulator of differentiation-dependent gene expression in keratinocytes, and been as a regulator of surface epithelia differentiation and apoptosis. p38 delta protein is upregulated in Cholangiocarcinoma (CC) relative to hepatocellularcarcinoma (HCC) and to normal biliary tract tissues. p38 delta is important for motility and invasion of CC cells, suggesting that p38 delta may play an important role in CC metastasis. p38 delta is expressed in the epidermis, suggesting a role for p38 delta in regulating differentiation. p38 delta is the major p38 isoform driving suprabasal involucrin gene expression and that p38 delta directly regulates ERK1/2 activity via formation of a p38 delta-ERK1/2 complex. Recent emerging evidence suggests that the p38 stress MAPK pathway may function as a tumor suppressor through regulating Ras-dependent and -independent proliferation, transformation, invasion and cell death by isoform-specific mechanisms. p38 delta has important role in promoting cell proliferation and tumor development in epidermis and may have therapeutic implication for skin cancer.

Full Name
mitogen-activated protein kinase 13
Research Areas
References
  • Efimova T, et al. (2003) A regulatory role for p38 delta MAPK in keratinocyte differentiation. Evidence for p38 delta-ERK1/2 complex formation. J Biol Chem. 278(36): 34277-85.
  • Eckert RL, et al. (2003) p38 Mitogen-activated protein kinases on the body surface--a function for p38 delta. J Invest Dermatol. 120(5): 823-8.
  • Loesch M, et al. (2008) The p38 MAPK stress pathway as a tumor suppressor or more? Front Biosci. 13: 3581-93.
  • Schindler EM, et al. (2009) p38delta Mitogen-activated protein kinase is essential for skin tumor development in mice. Cancer Res. 69(11): 4648-55.
  • Tan FL, et al. (2010) p38delta/MAPK13 as a diagnostic marker for cholangiocarcinoma and its involvement in cell motility and invasion. Int J Cancer. 126(10): 2353-61.
  • SAPK4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SAPK4 cDNA ORF Clone in Cloning Vector, Mouse MG51020-G
    SAPK4 cDNA ORF Clone, Mouse, untagged MG51020-UT
    SAPK4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51020-ACG
    SAPK4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51020-ACGLN
    SAPK4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51020-ANG
    SAPK4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51020-ACR
    SAPK4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51020-ANR
    SAPK4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51020-CF
    SAPK4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51020-NF
    SAPK4 cDNA ORF Clone, Mouse, C-His tag MG51020-CH
    SAPK4 cDNA ORF Clone, Mouse, N-His tag MG51020-NH
    SAPK4 cDNA ORF Clone, Mouse, C-HA tag MG51020-CY
    SAPK4 cDNA ORF Clone, Mouse, N-HA tag MG51020-NY
    SAPK4 cDNA ORF Clone, Mouse, C-Myc tag MG51020-CM
    SAPK4 cDNA ORF Clone, Mouse, N-Myc tag MG51020-NM
    SAPK4 qPCR Primer Pairs, Mouse MP200979

    SAPK4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SAPK4 cDNA ORF Clone in Cloning Vector, Human HG10747-M
    SAPK4 cDNA ORF Clone, Human, untagged HG10747-UT
    SAPK4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10747-ACGLN
    SAPK4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10747-ACG
    SAPK4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10747-ANG
    SAPK4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10747-ACR
    SAPK4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10747-ANR
    SAPK4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10747-CF
    SAPK4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10747-NF
    SAPK4 cDNA ORF Clone, Human, C-His tag HG10747-CH
    SAPK4 cDNA ORF Clone, Human, C-HA tag HG10747-CY
    SAPK4 cDNA ORF Clone, Human, N-HA tag HG10747-NY
    SAPK4 cDNA ORF Clone, Human, C-Myc tag HG10747-CM
    SAPK4 cDNA ORF Clone, Human, N-Myc tag HG10747-NM
    SAPK4 qPCR Primer Pairs, Human HP100680
    info info
    添加购物车成功! 添加购物车失败!