NGL-1/LRRC4C cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10988-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NGL-1/LRRC4C Reagents
CRO Services
Product recommended

All NGL-1/LRRC4C Reagents
NGL-1/LRRC4C cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1923 bp
Description
Full length Clone DNA of Human leucine rich repeat containing 4C with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NGL-1/LRRC4C cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
NGL-1 cDNA ORF Clone, Human;NGL1 cDNA ORF Clone, Human
NGL-1/LRRC4C Background Information
Full Name
leucine rich repeat containing 4C

NGL-1/LRRC4C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NGL-1/LRRC4C cDNA ORF Clone in Cloning Vector, Mouse MG50529-M
NGL-1/LRRC4C cDNA ORF Clone, Mouse, untagged MG50529-UT
NGL-1/LRRC4C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50529-ACG
NGL-1/LRRC4C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50529-ACGLN
NGL-1/LRRC4C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50529-ACR
NGL-1/LRRC4C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50529-CF
NGL-1/LRRC4C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50529-NF
NGL-1/LRRC4C cDNA ORF Clone, Mouse, C-His tag MG50529-CH
NGL-1/LRRC4C cDNA ORF Clone, Mouse, N-His tag MG50529-NH
NGL-1/LRRC4C cDNA ORF Clone, Mouse, C-HA tag MG50529-CY
NGL-1/LRRC4C cDNA ORF Clone, Mouse, N-HA tag MG50529-NY
NGL-1/LRRC4C cDNA ORF Clone, Mouse, C-Myc tag MG50529-CM
NGL-1/LRRC4C cDNA ORF Clone, Mouse, N-Myc tag MG50529-NM
NGL-1/LRRC4C qPCR Primer Pairs, Mouse MP200521

NGL-1/LRRC4C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NGL-1/LRRC4C cDNA ORF Clone in Cloning Vector, Human HG10988-M
NGL-1/LRRC4C cDNA ORF Clone, Human, untagged HG10988-UT
NGL-1/LRRC4C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10988-ACGLN
NGL-1/LRRC4C cDNA ORF Clone, Human, C-GFPSpark® tag HG10988-ACG
NGL-1/LRRC4C cDNA ORF Clone, Human, C-OFPSpark® tag HG10988-ACR
NGL-1/LRRC4C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10988-NF
NGL-1/LRRC4C cDNA ORF Clone, Human, C-His tag HG10988-CH
NGL-1/LRRC4C cDNA ORF Clone, Human, N-His tag HG10988-NH
NGL-1/LRRC4C cDNA ORF Clone, Human, C-HA tag HG10988-CY
NGL-1/LRRC4C cDNA ORF Clone, Human, N-HA tag HG10988-NY
NGL-1/LRRC4C cDNA ORF Clone, Human, C-Myc tag HG10988-CM
NGL-1/LRRC4C cDNA ORF Clone, Human, N-Myc tag HG10988-NM
NGL-1/LRRC4C qPCR Primer Pairs, Human HP100951
info info
添加购物车成功! 添加购物车失败!