LRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13371-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LRG1 Reagents
CRO Services
Product recommended

All LRG1 Reagents
LRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1026 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human leucine-rich alpha-2-glycoprotein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + NotI(6kb+1.03kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LRG1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5645
LRG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
HMFT1766 cDNA ORF Clone, Human;LRG cDNA ORF Clone, Human
LRG1 Background Information

LRG1 belongs to the leucine-rich repeat (LRR) family. Members of this family are involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is expressed during granulocyte differentiation. It contains 4 LIM zinc-binding domains and 1 Rho-GAP domain.

Full Name
leucine-rich alpha-2-glycoprotein 1
References
  • O Donnell LC. et al., 2002, J Leukoc Biol. 72 (3): 478-85.
  • Li X. et al., 2007, Neurosci Lett. 413 (2): 141-4.
  • Ramachandran P. et al., 2006, J Proteome Res. 5 (6): 1493-503.
  • LRG1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LRG1 cDNA ORF Clone in Cloning Vector, Mouse MG53549-G
    LRG1 cDNA ORF Clone, Mouse, untagged MG53549-UT
    LRG1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53549-ACG
    LRG1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53549-ACGLN
    LRG1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53549-ACR
    LRG1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53549-CF
    LRG1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53549-NF
    LRG1 cDNA ORF Clone, Mouse, C-His tag MG53549-CH
    LRG1 cDNA ORF Clone, Mouse, N-His tag MG53549-NH
    LRG1 cDNA ORF Clone, Mouse, C-HA tag MG53549-CY
    LRG1 cDNA ORF Clone, Mouse, N-HA tag MG53549-NY
    LRG1 cDNA ORF Clone, Mouse, C-Myc tag MG53549-CM
    LRG1 cDNA ORF Clone, Mouse, N-Myc tag MG53549-NM

    LRG1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LRG1 cDNA ORF Clone in Cloning Vector, Human HG13371-G
    LRG1 cDNA ORF Clone, Human, untagged HG13371-UT
    LRG1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13371-ACGLN
    LRG1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13371-ACG
    LRG1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13371-ACR
    LRG1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13371-CF
    LRG1 cDNA ORF Clone, Human, C-His tag HG13371-CH
    LRG1 cDNA ORF Clone, Human, N-His tag HG13371-NH
    LRG1 cDNA ORF Clone, Human, C-HA tag HG13371-CY
    LRG1 cDNA ORF Clone, Human, N-HA tag HG13371-NY
    LRG1 cDNA ORF Clone, Human, C-Myc tag HG13371-CM
    LRG1 cDNA ORF Clone, Human, N-Myc tag HG13371-NM
    LRG1 qPCR Primer Pairs, Human HP102076
    info info
    添加购物车成功! 添加购物车失败!