LIF cDNA ORF Clone, Human, N-Myc tag

Cat: HG14890-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LIF Reagents
CRO Services
Product recommended

All LIF Reagents
LIF cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
609 bp
Description
Full length Clone DNA of Human leukemia inhibitory factor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LIF cDNA ORF Clone, Human, N-Myc tag Alternative Names
CDF cDNA ORF Clone, Human;DIA cDNA ORF Clone, Human;HILDA cDNA ORF Clone, Human;Leukemia Inhibitory Factor cDNA ORF Clone, Human;MLPLI cDNA ORF Clone, Human
LIF Background Information

Leukemia inhibitory factor (LIF) is a pleiotropic glycoprotein belonging to the IL-6 family of cytokines. It’s involved in growth promotion and cell differentiation of different types of target cells, influence on bone metabolism, cachexia, neural development, embryogenesis and inflammation. LIF has potent proinflammatory property, being the inducer of the acute phase protein synthesis and affecting the cell recruitment into the area of damage or inflammation. LIF is also one of the cytokines that are capable to regulate the differentiation of embryonic stem cells, hematopoietic and neuronal cells. LIF binds to the specific LIF receptor (LIFR-α) which forms a heterodimer with a specific subunit common to all members of that family of receptors, the GP130 signal transducing subunit. This leads to activation of the JAK/STAT and MAPK cascades. Due to its polyfunctional activities, LIF is involved in the pathogenic events and development of many diseases of various origin.

Full Name
leukemia inhibitory factor
References
  • Salas EM, et al. (2011) LIF, a Novel STAT5-Regulated Gene, Is Aberrantly Expressed in Myeloproliferative Neoplasms. Genes Cancer. 2 (5): 593-6.
  • Chodorowska G, et al. (2004) Leukemia inhibitory factor (LIF) and its biological activity. Ann Univ Mariae Curie Sklodowska Med. 59 (2): 189-93.
  • Garcia-Campana AM, et al. (2007) LIF detection of peptides and proteins in CE. Electrophoresis. 28 (1-2): 208-32.
  • LIF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LIF cDNA ORF Clone in Cloning Vector, Mouse MG50755-G
    LIF cDNA ORF Clone in Cloning Vector, Mouse MG50756-G
    LIF cDNA ORF Clone, Mouse, untagged MG50756-UT
    LIF cDNA ORF Clone, Mouse, untagged MG50755-UT
    LIF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50755-ACGLN
    LIF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50756-ACGLN
    LIF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50756-ACG
    LIF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50755-ACG
    LIF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50756-ACR
    LIF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50755-ACR
    LIF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50755-CF
    LIF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50756-CF
    LIF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50755-NF
    LIF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50756-NF
    LIF cDNA ORF Clone, Mouse, C-His tag MG50756-CH
    LIF cDNA ORF Clone, Mouse, C-His tag MG50755-CH
    LIF cDNA ORF Clone, Mouse, N-His tag MG50756-NH
    LIF cDNA ORF Clone, Mouse, N-His tag MG50755-NH
    LIF cDNA ORF Clone, Mouse, C-HA tag MG50755-CY
    LIF cDNA ORF Clone, Mouse, C-HA tag MG50756-CY
    LIF cDNA ORF Clone, Mouse, N-HA tag MG50756-NY
    LIF cDNA ORF Clone, Mouse, N-HA tag MG50755-NY
    LIF cDNA ORF Clone, Mouse, C-Myc tag MG50756-CM
    LIF cDNA ORF Clone, Mouse, C-Myc tag MG50755-CM
    LIF cDNA ORF Clone, Mouse, N-Myc tag MG50755-NM
    LIF cDNA ORF Clone, Mouse, N-Myc tag MG50756-NM
    LIF qPCR Primer Pairs, Mouse MP200730

    LIF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LIF cDNA ORF Clone in Cloning Vector, Human HG14890-G
    LIF cDNA ORF Clone, Human, untagged HG14890-UT
    LIF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14890-ACGLN
    LIF cDNA ORF Clone, Human, C-GFPSpark® tag HG14890-ACG
    LIF cDNA ORF Clone, Human, C-OFPSpark® tag HG14890-ACR
    LIF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14890-CF
    LIF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14890-NF
    LIF cDNA ORF Clone, Human, C-His tag HG14890-CH
    LIF cDNA ORF Clone, Human, N-His tag HG14890-NH
    LIF cDNA ORF Clone, Human, C-HA tag HG14890-CY
    LIF cDNA ORF Clone, Human, N-HA tag HG14890-NY
    LIF cDNA ORF Clone, Human, C-Myc tag HG14890-CM
    LIF qPCR Primer Pairs, Human HP103197
    info info
    添加购物车成功! 添加购物车失败!