LCP2/SLP-76 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11237-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All LCP2/SLP-76 Reagents

CRO Services

Product recommended


All LCP2/SLP-76 Reagents

LCP2/SLP-76 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1602 bp
Description
Full length Clone DNA of Human lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LCP2/SLP-76 cDNA ORF Clone, Human, C-Myc tag Alternative Names

SLP-76 cDNA ORF Clone, Human;SLP76 cDNA ORF Clone, Human

LCP2/SLP-76 Background Information

Full Name
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)

LCP2/SLP-76 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LCP2/SLP-76 cDNA ORF Clone in Cloning Vector, Mouse MG53752-U
LCP2/SLP-76 cDNA ORF Clone, Mouse, untagged MG53752-UT
LCP2/SLP-76 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53752-ACG
LCP2/SLP-76 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53752-ACGLN
LCP2/SLP-76 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53752-ANG
LCP2/SLP-76 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53752-ACR
LCP2/SLP-76 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53752-ANR
LCP2/SLP-76 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53752-CF
LCP2/SLP-76 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53752-NF
LCP2/SLP-76 cDNA ORF Clone, Mouse, C-His tag MG53752-CH
LCP2/SLP-76 cDNA ORF Clone, Mouse, N-His tag MG53752-NH
LCP2/SLP-76 cDNA ORF Clone, Mouse, C-HA tag MG53752-CY
LCP2/SLP-76 cDNA ORF Clone, Mouse, N-HA tag MG53752-NY
LCP2/SLP-76 cDNA ORF Clone, Mouse, C-Myc tag MG53752-CM
LCP2/SLP-76 cDNA ORF Clone, Mouse, N-Myc tag MG53752-NM

LCP2/SLP-76 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LCP2/SLP-76 cDNA ORF Clone in Cloning Vector, Human HG11237-M
LCP2/SLP-76 cDNA ORF Clone, Human, untagged HG11237-UT
LCP2/SLP-76 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11237-ACGLN
LCP2/SLP-76 cDNA ORF Clone, Human, C-GFPSpark® tag HG11237-ACG
LCP2/SLP-76 cDNA ORF Clone, Human, N-GFPSpark® tag HG11237-ANG
LCP2/SLP-76 cDNA ORF Clone, Human, C-OFPSpark® tag HG11237-ACR
LCP2/SLP-76 cDNA ORF Clone, Human, N-OFPSpark® tag HG11237-ANR
LCP2/SLP-76 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11237-CF
LCP2/SLP-76 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11237-NF
LCP2/SLP-76 cDNA ORF Clone, Human, C-His tag HG11237-CH
LCP2/SLP-76 cDNA ORF Clone, Human, N-His tag HG11237-NH
LCP2/SLP-76 cDNA ORF Clone, Human, C-HA tag HG11237-CY
LCP2/SLP-76 cDNA ORF Clone, Human, N-HA tag HG11237-NY
LCP2/SLP-76 cDNA ORF Clone, Human, N-Myc tag HG11237-NM
LCP2/SLP-76 qPCR Primer Pairs, Human HP101181
info info
添加购物车成功! 添加购物车失败!