LATS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16302-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LATS1 Reagents
CRO Services
Product recommended

All LATS1 Reagents
LATS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2073 bp
Description
Full length Clone DNA of Human large tumor suppressor kinase 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LATS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
WARTS cDNA ORF Clone, Human;wts cDNA ORF Clone, Human
LATS1 Background Information
Full Name
large tumor suppressor kinase 1

LATS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LATS1 cDNA ORF Clone in Cloning Vector, Mouse MG59839-U
LATS1 cDNA ORF Clone, Mouse, untagged MG59839-UT
LATS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59839-ACGLN
LATS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59839-ACG
LATS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59839-ANG
LATS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59839-ACR
LATS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59839-ANR
LATS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59839-CF
LATS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59839-NF
LATS1 cDNA ORF Clone, Mouse, C-His tag MG59839-CH
LATS1 cDNA ORF Clone, Mouse, N-His tag MG59839-NH
LATS1 cDNA ORF Clone, Mouse, C-HA tag MG59839-CY
LATS1 cDNA ORF Clone, Mouse, N-HA tag MG59839-NY
LATS1 cDNA ORF Clone, Mouse, C-Myc tag MG59839-CM
LATS1 cDNA ORF Clone, Mouse, N-Myc tag MG59839-NM

LATS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LATS1 cDNA ORF Clone in Cloning Vector, Human HG16302-G
LATS1 cDNA ORF Clone, Human, untagged HG16302-UT
LATS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16302-ACGLN
LATS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16302-ACG
LATS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16302-ANG
LATS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16302-ACR
LATS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16302-ANR
LATS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16302-NF
LATS1 cDNA ORF Clone, Human, C-His tag HG16302-CH
LATS1 cDNA ORF Clone, Human, N-His tag HG16302-NH
LATS1 cDNA ORF Clone, Human, C-HA tag HG16302-CY
LATS1 cDNA ORF Clone, Human, N-HA tag HG16302-NY
LATS1 cDNA ORF Clone, Human, C-Myc tag HG16302-CM
LATS1 cDNA ORF Clone, Human, N-Myc tag HG16302-NM
LATS1 qPCR Primer Pairs, Human HP105056
info info
添加购物车成功! 添加购物车失败!