Cytokeratin 14 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13109-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cytokeratin 14 Reagents
CRO Services
Product recommended

All Cytokeratin 14 Reagents
Cytokeratin 14 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1419 bp
Description
Full length Clone DNA of Human keratin 14 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 14 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CK14 cDNA ORF Clone, Human;EBS3 cDNA ORF Clone, Human;EBS4 cDNA ORF Clone, Human;K14 cDNA ORF Clone, Human;NFJ cDNA ORF Clone, Human
Cytokeratin 14 Background Information

Cytokeratin 14, also known as Keratin 14 and K14, is a member of the keratin family. Cytokeratin 14 is a type I keratin. It is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Cytokeratin 14 is mainly expressed in the basal layer. It is also strongly expressed in the outer root sheath of anagen follicles. Cytokeratin 14 and keratin 5 may have a role in maintenance of cell proliferation potential in the basal layer of stratified epithelia, modulating phosphatidylinositol 3-kinase/Akt–mediated cell proliferation and/or Notch1-dependent cell differentiation. Cytokeratin 14 defect prevents it from working effectively with keratin 5 and interfering with the assembly of the keratin intermediate filament network. A disruption in this network makes keratinocytes fragile and prone to rupture. Minor trauma to the skin, such as rubbing or scratching, can cause these cells to break down, resulting in the formation of painful, fluid-filled blisters. Mutations in the K14 gene are also responsible for Naegeli-Franceschetti-Jadassohn syndrome and dermatopathia pigmentosa reticularis.

Full Name
keratin 14, type I
References
  • Coulombe PA, et al., 1991, Cell. 66(6): 1301-11.
  • Schweizer J, et al., 2006, 174(2): 169-74.
  • Lugassy J, et al., 2006, Am J Hum Genet. 79(4): 724-30.
  • Cytokeratin 14 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cytokeratin 14 cDNA ORF Clone in Cloning Vector, Rat RG80965-U
    Cytokeratin 14 cDNA ORF Clone, Rat, untagged RG80965-UT
    Cytokeratin 14 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80965-ACGLN
    Cytokeratin 14 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80965-ACG
    Cytokeratin 14 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80965-ANG
    Cytokeratin 14 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80965-ACR
    Cytokeratin 14 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80965-ANR
    Cytokeratin 14 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80965-CF
    Cytokeratin 14 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80965-NF
    Cytokeratin 14 cDNA ORF Clone, Rat, C-His tag RG80965-CH
    Cytokeratin 14 cDNA ORF Clone, Rat, N-His tag RG80965-NH
    Cytokeratin 14 cDNA ORF Clone, Rat, C-HA tag RG80965-CY
    Cytokeratin 14 cDNA ORF Clone, Rat, N-HA tag RG80965-NY
    Cytokeratin 14 cDNA ORF Clone, Rat, C-Myc tag RG80965-CM
    Cytokeratin 14 cDNA ORF Clone, Rat, N-Myc tag RG80965-NM
    Cytokeratin 14 qPCR Primer Pairs, Rat RP300929

    Cytokeratin 14 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cytokeratin 14 cDNA ORF Clone in Cloning Vector, Mouse MG57223-U
    Cytokeratin 14 cDNA ORF Clone, Mouse, untagged MG57223-UT
    Cytokeratin 14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57223-ACG
    Cytokeratin 14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57223-ACGLN
    Cytokeratin 14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57223-ANG
    Cytokeratin 14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57223-ACR
    Cytokeratin 14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57223-ANR
    Cytokeratin 14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57223-CF
    Cytokeratin 14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57223-NF
    Cytokeratin 14 cDNA ORF Clone, Mouse, C-His tag MG57223-CH
    Cytokeratin 14 cDNA ORF Clone, Mouse, N-His tag MG57223-NH
    Cytokeratin 14 cDNA ORF Clone, Mouse, C-HA tag MG57223-CY
    Cytokeratin 14 cDNA ORF Clone, Mouse, N-HA tag MG57223-NY
    Cytokeratin 14 cDNA ORF Clone, Mouse, C-Myc tag MG57223-CM
    Cytokeratin 14 cDNA ORF Clone, Mouse, N-Myc tag MG57223-NM

    Cytokeratin 14 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cytokeratin 14 cDNA ORF Clone in Cloning Vector, Human HG13109-G
    Cytokeratin 14 cDNA ORF Clone, Human, untagged HG13109-UT
    Cytokeratin 14 cDNA ORF Clone, Human, C-GFPSpark® tag HG13109-ACG
    Cytokeratin 14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13109-ACGLN
    Cytokeratin 14 cDNA ORF Clone, Human, N-GFPSpark® tag HG13109-ANG
    Cytokeratin 14 cDNA ORF Clone, Human, C-OFPSpark® tag HG13109-ACR
    Cytokeratin 14 cDNA ORF Clone, Human, N-OFPSpark® tag HG13109-ANR
    Cytokeratin 14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13109-CF
    Cytokeratin 14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13109-NF
    Cytokeratin 14 cDNA ORF Clone, Human, C-His tag HG13109-CH
    Cytokeratin 14 cDNA ORF Clone, Human, N-His tag HG13109-NH
    Cytokeratin 14 cDNA ORF Clone, Human, C-HA tag HG13109-CY
    Cytokeratin 14 cDNA ORF Clone, Human, N-HA tag HG13109-NY
    Cytokeratin 14 cDNA ORF Clone, Human, C-Myc tag HG13109-CM
    Cytokeratin 14 qPCR Primer Pairs, Human HP101731
    info info
    添加购物车成功! 添加购物车失败!