KLRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10984-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All KLRF1 Reagents
CRO Services
Product recommended

All KLRF1 Reagents
KLRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
696 bp
Description
Full length Clone DNA of Human Killer ell lectin-like receptor subfamily F, member 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KLRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CLEC5C cDNA ORF Clone, Human;NKp80 cDNA ORF Clone, Human
KLRF1 Background Information

NKp80, also known as KLRF1, is an activating homodimeric C-type lectin-like receptor which is expressed on nearly all natural killer cells and stimulates their cytoxicity and cytokine release. NKp80 stimulates cytotoxicity upon engagement of its genetically linked ligand: myeloid-specific CTLR activation-induced C-type lectin (AICL). NKp80, but not NKp80 mutated at tyrosine 7 (NKp80/Y7F), is tyrosine phosphorylated. Accordingly, NKp80/Y7F, but not NKp80/Y30F or NKp80/Y37F, failed to induce cytotoxicity. NKp80 phosphopeptides comprising the hemi-ITAM-like sequence surrounding tyrosine 7 bound Lck- and Syk-family kinases; accordingly, cross-linking of NKp80, but not NKp80/Y7F, induced Syk phosphorylation. Moreover, inhibition of Syk kinase, but not ZAP-70 kinase, impaired cytotoxic responses through NKp80. Atypical residues in the hemi-ITAM-like motif of NKp80 cause an altered stoichiometry of phosphorylation but did not substantially affect NK cytotoxicity. Altogether, these results show that NKp80 uses an atypical hemi-ITAM and Syk kinase to trigger cellular cytotoxicity.

Full Name
killer cell lectin like receptor F1
References
  • Kuttruff S. et al., 2009, Blood. 113 (2): 358-69.
  • Dennehy KM. et al., 2011, J Immunol. 186 (2): 657-61.
  • Roda-Navarro P. et al., 2000, Eur J Immunol. 30 (2): 568-76.
  • KLRF1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    KLRF1 cDNA ORF Clone in Cloning Vector, Rhesus CG90165-G
    KLRF1 cDNA ORF Clone, Rhesus, untagged CG90165-UT
    KLRF1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90165-ACGLN
    KLRF1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90165-ACG
    KLRF1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90165-ACR
    KLRF1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90165-CF
    KLRF1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90165-NF
    KLRF1 cDNA ORF Clone, Rhesus, C-His tag CG90165-CH
    KLRF1 cDNA ORF Clone, Rhesus, N-His tag CG90165-NH
    KLRF1 cDNA ORF Clone, Rhesus, C-HA tag CG90165-CY
    KLRF1 cDNA ORF Clone, Rhesus, N-HA tag CG90165-NY
    KLRF1 cDNA ORF Clone, Rhesus, C-Myc tag CG90165-CM
    KLRF1 cDNA ORF Clone, Rhesus, N-Myc tag CG90165-NM

    KLRF1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    KLRF1 cDNA ORF Clone in Cloning Vector, Human HG10984-M
    KLRF1 cDNA ORF Clone, Human, untagged HG10984-UT
    KLRF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10984-ACGLN
    KLRF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10984-ACG
    KLRF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10984-ACR
    KLRF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10984-NF
    KLRF1 cDNA ORF Clone, Human, C-His tag HG10984-CH
    KLRF1 cDNA ORF Clone, Human, N-His tag HG10984-NH
    KLRF1 cDNA ORF Clone, Human, C-HA tag HG10984-CY
    KLRF1 cDNA ORF Clone, Human, N-HA tag HG10984-NY
    KLRF1 cDNA ORF Clone, Human, C-Myc tag HG10984-CM
    KLRF1 cDNA ORF Clone, Human, N-Myc tag HG10984-NM
    KLRF1 qPCR Primer Pairs, Human HP100948
    info info
    添加购物车成功! 添加购物车失败!