LFA-1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10812-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LFA-1 Reagents
CRO Services
Product recommended

All LFA-1 Reagents
LFA-1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3513 bp
Description
Full length Clone DNA of Human integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LFA-1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD11A cDNA ORF Clone, Human;LFA-1 cDNA ORF Clone, Human;LFA1A cDNA ORF Clone, Human
LFA-1 Background Information
Full Name
integrin subunit alpha L

LFA-1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LFA-1 cDNA ORF Clone in Cloning Vector, Rat RG80435-G
LFA-1 cDNA ORF Clone, Rat, untagged RG80435-UT
LFA-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80435-ACGLN
LFA-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80435-ACG
LFA-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80435-ACR
LFA-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80435-CF
LFA-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80435-NF
LFA-1 cDNA ORF Clone, Rat, C-His tag RG80435-CH
LFA-1 cDNA ORF Clone, Rat, N-His tag RG80435-NH
LFA-1 cDNA ORF Clone, Rat, C-HA tag RG80435-CY
LFA-1 cDNA ORF Clone, Rat, N-HA tag RG80435-NY
LFA-1 cDNA ORF Clone, Rat, C-Myc tag RG80435-CM
LFA-1 cDNA ORF Clone, Rat, N-Myc tag RG80435-NM
LFA-1 qPCR Primer Pairs, Rat RP300407

LFA-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LFA-1 cDNA ORF Clone in Cloning Vector, Human HG10812-M
LFA-1 cDNA ORF Clone, Human, untagged HG10812-UT
LFA-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10812-ACG
LFA-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10812-ACGLN
LFA-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10812-ACR
LFA-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10812-CF
LFA-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10812-NF
LFA-1 cDNA ORF Clone, Human, C-His tag HG10812-CH
LFA-1 cDNA ORF Clone, Human, N-His tag HG10812-NH
LFA-1 cDNA ORF Clone, Human, C-HA tag HG10812-CY
LFA-1 cDNA ORF Clone, Human, N-HA tag HG10812-NY
LFA-1 cDNA ORF Clone, Human, C-Myc tag HG10812-CM
LFA-1 qPCR Primer Pairs, Human HP100915
info info
添加购物车成功! 添加购物车失败!