IST1 cDNA ORF Clone, Human, C-His tag

Cat: HG16345-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IST1 Reagents
CRO Services
Product recommended

All IST1 Reagents
IST1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1101 bp
Description
Full length Clone DNA of Human increased sodium tolerance 1 homolog (yeast) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IST1 cDNA ORF Clone, Human, C-His tag Alternative Names
OLC1 cDNA ORF Clone, Human
IST1 Background Information
Full Name
increased sodium tolerance 1 homolog (yeast)

IST1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IST1 cDNA ORF Clone in Cloning Vector, Mouse MG51383-U
IST1 cDNA ORF Clone, Mouse, untagged MG51383-UT
IST1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51383-ACGLN
IST1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51383-ACG
IST1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51383-ANG
IST1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51383-ACR
IST1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51383-ANR
IST1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51383-CF
IST1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51383-NF
IST1 cDNA ORF Clone, Mouse, C-His tag MG51383-CH
IST1 cDNA ORF Clone, Mouse, N-His tag MG51383-NH
IST1 cDNA ORF Clone, Mouse, C-HA tag MG51383-CY
IST1 cDNA ORF Clone, Mouse, N-HA tag MG51383-NY
IST1 cDNA ORF Clone, Mouse, C-Myc tag MG51383-CM
IST1 cDNA ORF Clone, Mouse, N-Myc tag MG51383-NM
IST1 qPCR Primer Pairs, Mouse MP201256

IST1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IST1 cDNA ORF Clone in Cloning Vector, Human HG16345-G
IST1 cDNA ORF Clone, Human, untagged HG16345-UT
IST1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16345-ACGLN
IST1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16345-ACG
IST1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16345-ANG
IST1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16345-ACR
IST1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16345-ANR
IST1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16345-CF
IST1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16345-NF
IST1 cDNA ORF Clone, Human, N-His tag HG16345-NH
IST1 cDNA ORF Clone, Human, C-HA tag HG16345-CY
IST1 cDNA ORF Clone, Human, N-HA tag HG16345-NY
IST1 cDNA ORF Clone, Human, C-Myc tag HG16345-CM
IST1 cDNA ORF Clone, Human, N-Myc tag HG16345-NM
IST1 qPCR Primer Pairs, Human HP105098
info info
添加购物车成功! 添加购物车失败!