IL-1F6 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10607-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-1F6 Reagents
CRO Services
Product recommended

All IL-1F6 Reagents
IL-1F6 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
522 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 family, member 6 (epsilon) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI(6kb+0.52kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL-1F6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-1F6 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
IL-1F6 cDNA ORF Clone, Human, C-Myc tag Alternative Names
1E cDNA ORF Clone, Human;FIL cDNA ORF Clone, Human;FIL1 cDNA ORF Clone, Human;FIL1(EPSILON) cDNA ORF Clone, Human;FIL1E cDNA ORF Clone, Human;IL-1F6 cDNA ORF Clone, Human;IL1(EPSILON) cDNA ORF Clone, Human;IL1E cDNA ORF Clone, Human;IL1F6 cDNA ORF Clone, Human;IL36A cDNA ORF Clone, Human
IL-1F6 Background Information

Interleukin-1 family member 6 (IL-1F6), also known as interleukin 36, alpha (IL36A), is a pro-inflammatory cytokine which plays an important role in innate and adaptive immunity. IL-1F6 activates MAPK and NF-kB pathways and is produced by many different cells. This cytokine is a family member of interleukin-1 (IL-1) and plays an important role in the pathophysiology of several diseases. It has been reported that IL-1F6 and IL-1F8, in addition to IL-1F9, activate the pathway leading to NF-kappaB in an IL-1Rrp2-dependent manner in Jurkat cells as well as in multiple other human and mouse cell lines. Activation of the pathway leading to NF-kappaB by IL-1F6 and IL-1F8 follows a similar time course to activation by IL-1beta, suggesting that signaling by the novel family members occurs through a direct mechanism. In a mammary epithelial cell line, NCI/ADR-RES, which naturally expresses IL-1Rrp2, all three cytokines signal without further receptor transfection. IL-1Rrp2 antibodies block activation of the pathway leading to NF-kappaB by IL-1F6, IL-1F8, and IL-1F9 in both Jurkat and NCI/ADR-RES cells. Thus IL-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP.

Full Name
interleukin 36, alpha
References
  • Tripodi D, et al. (2012) IL-36 a new member of the IL-1 family cytokines. J Biol Regul Homeost Agents. 26(1):7-14.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Kumar S, et al. (2000) Identification and initial characterization of four novel members of the interleukin-1 family. J Biol Chem. 275(14): 10308-14.
  • IL-1F6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-1F6 cDNA ORF Clone in Cloning Vector, Mouse MG50095-M
    IL-1F6 cDNA ORF Clone, Mouse, untagged MG50095-UT
    IL-1F6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50095-ACGLN
    IL-1F6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50095-ACG
    IL-1F6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50095-ACR
    IL-1F6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50095-CF
    IL-1F6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50095-NF
    IL-1F6 cDNA ORF Clone, Mouse, C-His tag MG50095-CH
    IL-1F6 cDNA ORF Clone, Mouse, N-His tag MG50095-NH
    IL-1F6 cDNA ORF Clone, Mouse, C-HA tag MG50095-CY
    IL-1F6 cDNA ORF Clone, Mouse, N-HA tag MG50095-NY
    IL-1F6 cDNA ORF Clone, Mouse, C-Myc tag MG50095-CM
    IL-1F6 cDNA ORF Clone, Mouse, N-Myc tag MG50095-NM
    IL-1F6 qPCR Primer Pairs, Mouse MP200125

    IL-1F6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-1F6 cDNA ORF Clone in Cloning Vector, Human HG10607-M
    IL-1F6 cDNA ORF Clone, Human, untagged HG10607-UT
    IL-1F6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10607-ACGLN
    IL-1F6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10607-ACG
    IL-1F6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10607-ACR
    IL-1F6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10607-CF
    IL-1F6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10607-NF
    IL-1F6 cDNA ORF Clone, Human, C-His tag HG10607-CH
    IL-1F6 cDNA ORF Clone, Human, N-His tag HG10607-NH
    IL-1F6 cDNA ORF Clone, Human, C-HA tag HG10607-CY
    IL-1F6 cDNA ORF Clone, Human, N-HA tag HG10607-NY
    IL-1F6 cDNA ORF Clone, Human, N-Myc tag HG10607-NM
    IL-1F6 qPCR Primer Pairs, Human HP100594
    info info
    添加购物车成功! 添加购物车失败!