CD132 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10555-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD132 Reagents
CRO Services
Product recommended

All CD132 Reagents
CD132 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1110 bp
Description
Full length Clone DNA of Human interleukin 2 receptor, gamma (severe combined immunodeficiency) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD132 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CD132 cDNA ORF Clone, Human;CIDX cDNA ORF Clone, Human;IL-2RG cDNA ORF Clone, Human;IMD4 cDNA ORF Clone, Human;P64 cDNA ORF Clone, Human;SCIDX cDNA ORF Clone, Human;SCIDX1 cDNA ORF Clone, Human
CD132 Background Information

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.

Full Name
interleukin 2 receptor, gamma
References
  • Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.
  • Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.
  • Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.
  • CD132 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD132 cDNA ORF Clone in Cloning Vector, Rhesus CG90119-G
    CD132 cDNA ORF Clone, Rhesus, untagged CG90119-UT
    CD132 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90119-ACG
    CD132 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90119-ACGLN
    CD132 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90119-ACR
    CD132 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90119-CF
    CD132 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90119-NF
    CD132 cDNA ORF Clone, Rhesus, C-His tag CG90119-CH
    CD132 cDNA ORF Clone, Rhesus, N-His tag CG90119-NH
    CD132 cDNA ORF Clone, Rhesus, C-HA tag CG90119-CY
    CD132 cDNA ORF Clone, Rhesus, N-HA tag CG90119-NY
    CD132 cDNA ORF Clone, Rhesus, C-Myc tag CG90119-CM
    CD132 cDNA ORF Clone, Rhesus, N-Myc tag CG90119-NM

    CD132 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD132 cDNA ORF Clone in Cloning Vector, Rat RG80197-G
    CD132 cDNA ORF Clone, Rat, untagged RG80197-UT
    CD132 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80197-ACGLN
    CD132 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80197-ACG
    CD132 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80197-ACR
    CD132 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80197-G-F
    CD132 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80197-CF
    CD132 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80197-NF
    CD132 cDNA ORF Clone, Rat, C-His tag RG80197-CH
    CD132 cDNA ORF Clone, Rat, N-His tag RG80197-NH
    CD132 cDNA ORF Clone, Rat, C-HA tag RG80197-CY
    CD132 cDNA ORF Clone, Rat, N-HA tag RG80197-NY
    CD132 cDNA ORF Clone, Rat, C-Myc tag RG80197-CM
    CD132 cDNA ORF Clone, Rat, N-Myc tag RG80197-NM
    CD132 qPCR Primer Pairs, Rat RP300189

    CD132 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD132 cDNA ORF Clone in Cloning Vector, Mouse MG50087-M
    CD132 cDNA ORF Clone, Mouse, untagged MG50087-UT
    CD132 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50087-ACG
    CD132 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50087-ACGLN
    CD132 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50087-ACR
    CD132 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50087-CF
    CD132 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50087-NF
    CD132 cDNA ORF Clone, Mouse, C-His tag MG50087-CH
    CD132 cDNA ORF Clone, Mouse, N-His tag MG50087-NH
    CD132 cDNA ORF Clone, Mouse, C-HA tag MG50087-CY
    CD132 cDNA ORF Clone, Mouse, N-HA tag MG50087-NY
    CD132 cDNA ORF Clone, Mouse, C-Myc tag MG50087-CM
    CD132 cDNA ORF Clone, Mouse, N-Myc tag MG50087-NM
    CD132 qPCR Primer Pairs, Mouse MP200117

    CD132 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD132 cDNA ORF Clone in Cloning Vector, Human HG10555-M
    CD132 cDNA ORF Clone, Human, untagged HG10555-UT
    CD132 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10555-ACGLN
    CD132 cDNA ORF Clone, Human, C-GFPSpark® tag HG10555-ACG
    CD132 cDNA ORF Clone, Human, C-OFPSpark® tag HG10555-ACR
    CD132 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10555-CF
    CD132 cDNA ORF Clone, Human, C-His tag HG10555-CH
    CD132 cDNA ORF Clone, Human, N-His tag HG10555-NH
    CD132 cDNA ORF Clone, Human, C-HA tag HG10555-CY
    CD132 cDNA ORF Clone, Human, N-HA tag HG10555-NY
    CD132 cDNA ORF Clone, Human, C-Myc tag HG10555-CM
    CD132 cDNA ORF Clone, Human, N-Myc tag HG10555-NM
    CD132 qPCR Primer Pairs, Human HP100057
    info info
    添加购物车成功! 添加购物车失败!