IL21 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10584-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL21 Reagents
CRO Services
Product recommended

All IL21 Reagents
IL21 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
RefSeq ORF Size
405 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 21 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI (6kb + 0.45kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL21 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL21 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
IL21 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CVID11 cDNA ORF Clone, Human;IL-21 cDNA ORF Clone, Human;Za11 cDNA ORF Clone, Human
IL21 Background Information

IL21 belongs to the IL-15/IL-21 family. It is a cytokine with immunoregulatory activity. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. IL21 is expressed in activated CD4-positive T-cells but not in CD8-positive T-cells, B-cells, or monocytes. It may promote the transition between innate and adaptive immunity. IL-21 has been tried as therapy for alleviating allergic responses. It can significantly decrease pro-inflammatory cytokines produced by T cells in addition to decreasing IgE levels in a mouse model for rhinitis (nasal passage inflammation)

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 21
References
  • Coquet JM, et al. (2007) IL-21 is produced by NKT cells and modulates NKT cell activation and cytokine production. J Immunol. 178(5):2827-34.
  • Wei L, et al. (2007) IL-21 is produced by Th17 cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem. 282(48):34605-10.
  • Parrish-Novak J, et al. (2002) Interleukin-21 and the IL-21 receptor: novel effectors of NK and T cell responses. J Leukoc Biol. 72(5):856-63. 4 Kuchen S, et al. (2007) Essential role of IL-21 in B cell activation, expansion, and plasma cell generation during CD4+ T cell-B cell collaboration. J Immunol. 179(9):5886-96.
  • IL21 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL21 cDNA ORF Clone in Cloning Vector, Rhesus CG90298-G
    IL21 cDNA ORF Clone, Rhesus, untagged CG90298-UT
    IL21 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90298-ACG
    IL21 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90298-ACGLN
    IL21 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90298-ACR
    IL21 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90298-CF
    IL21 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90298-NF
    IL21 cDNA ORF Clone, Rhesus, C-His tag CG90298-CH
    IL21 cDNA ORF Clone, Rhesus, N-His tag CG90298-NH
    IL21 cDNA ORF Clone, Rhesus, C-HA tag CG90298-CY
    IL21 cDNA ORF Clone, Rhesus, N-HA tag CG90298-NY
    IL21 cDNA ORF Clone, Rhesus, C-Myc tag CG90298-CM
    IL21 cDNA ORF Clone, Rhesus, N-Myc tag CG90298-NM

    IL21 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL21 cDNA ORF Clone in Cloning Vector, Canine DG70016-G
    IL21 cDNA ORF Clone, Canine, untagged DG70016-UT
    IL21 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70016-ACG
    IL21 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70016-ACGLN
    IL21 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70016-ACR
    IL21 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70016-CF
    IL21 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70016-NF
    IL21 cDNA ORF Clone, Canine, C-His tag DG70016-CH
    IL21 cDNA ORF Clone, Canine, N-His tag DG70016-NH
    IL21 cDNA ORF Clone, Canine, C-HA tag DG70016-CY
    IL21 cDNA ORF Clone, Canine, N-HA tag DG70016-NY
    IL21 cDNA ORF Clone, Canine, C-Myc tag DG70016-CM
    IL21 cDNA ORF Clone, Canine, N-Myc tag DG70016-NM

    IL21 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL21 cDNA ORF Clone in Cloning Vector, Rat RG80200-G
    IL21 cDNA ORF Clone, Rat, untagged RG80200-UT
    IL21 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80200-ACGLN
    IL21 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80200-ACG
    IL21 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80200-ACR
    IL21 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80200-CF
    IL21 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80200-NF
    IL21 cDNA ORF Clone, Rat, C-His tag RG80200-CH
    IL21 cDNA ORF Clone, Rat, N-His tag RG80200-NH
    IL21 cDNA ORF Clone, Rat, C-HA tag RG80200-CY
    IL21 cDNA ORF Clone, Rat, N-HA tag RG80200-NY
    IL21 cDNA ORF Clone, Rat, C-Myc tag RG80200-CM
    IL21 cDNA ORF Clone, Rat, N-Myc tag RG80200-NM
    IL21 qPCR Primer Pairs, Rat RP300192

    IL21 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL21 cDNA ORF Clone in Cloning Vector, Mouse MG50137-M
    IL21 cDNA ORF Clone, Mouse, untagged MG50137-UT
    IL21 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50137-ACG
    IL21 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50137-ACGLN
    IL21 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50137-ACR
    IL21 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50137-CF
    IL21 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50137-NF
    IL21 cDNA ORF Clone, Mouse, C-His tag MG50137-CH
    IL21 cDNA ORF Clone, Mouse, N-His tag MG50137-NH
    IL21 cDNA ORF Clone, Mouse, C-HA tag MG50137-CY
    IL21 cDNA ORF Clone, Mouse, N-HA tag MG50137-NY
    IL21 cDNA ORF Clone, Mouse, C-Myc tag MG50137-CM
    IL21 cDNA ORF Clone, Mouse, N-Myc tag MG50137-NM
    IL21 qPCR Primer Pairs, Mouse MP200167

    IL21 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL21 cDNA ORF Clone in Cloning Vector, Human HG10584-M
    IL21 cDNA ORF Clone, Human, untagged HG10584-UT
    IL21 cDNA ORF Clone, Human, C-GFPSpark® tag HG10584-ACG
    IL21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10584-ACGLN
    IL21 cDNA ORF Clone, Human, C-OFPSpark® tag HG10584-ACR
    IL21 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10584-CF
    IL21 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10584-NF
    IL21 cDNA ORF Clone, Human, C-His tag HG10584-CH
    IL21 cDNA ORF Clone, Human, N-His tag HG10584-NH
    IL21 cDNA ORF Clone, Human, C-HA tag HG10584-CY
    IL21 cDNA ORF Clone, Human, N-HA tag HG10584-NY
    IL21 cDNA ORF Clone, Human, N-Myc tag HG10584-NM
    IL21 qPCR Primer Pairs, Human HP100860
    info info
    添加购物车成功! 添加购物车失败!