IL12RB2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10145-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IL12RB2 Reagents

CRO Services

Product recommended


All IL12RB2 Reagents

IL12RB2 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2589 bp
Description
Full length Clone DNA of Human interleukin 12 receptor, beta 2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL12RB2 Background Information

Interleukin-12 receptor subunit beta-2 (IL12RB2), also known as IL-12 receptor subunit beta-2, IL-12R subunit beta-2, IL-12R-beta-2, and IL-12RB2, is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. IL12RB2 belongs to the type I cytokine receptor family. The coexpression of IL12RB2 and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of IL12RB2 is up-regulated by IFN gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of IL12RB2 is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. This subunit is the signaling component coupling to the JAK2/STAT4 pathway. IL12RB2 promotes the proliferation of T-cells as well as NK cells. IL12RB2 induces the promotion of T-cells towards the Th1 phenotype by strongly enhancing IFN-gamma production.

Full Name
interleukin 12 receptor, beta 2
References
  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. 77 (3-4): 257-8.
  • Morton SM, et al. (1998) Assignment of IL12RB2 to human chromosome 1p31.3→p31.2 between D1S230 and D1S198. Cytogenet. Cell Genet. 79 (3-4): 282-3.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA. 99 (26): 16899-903.
  • IL12RB2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL12RB2 cDNA ORF Clone in Cloning Vector, Canine DG70085-G
    IL12RB2 cDNA ORF Clone, Canine, untagged DG70085-UT
    IL12RB2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70085-ACG
    IL12RB2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70085-ACGLN
    IL12RB2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70085-ACR
    IL12RB2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70085-CF
    IL12RB2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70085-NF
    IL12RB2 cDNA ORF Clone, Canine, C-His tag DG70085-CH
    IL12RB2 cDNA ORF Clone, Canine, N-His tag DG70085-NH
    IL12RB2 cDNA ORF Clone, Canine, C-HA tag DG70085-CY
    IL12RB2 cDNA ORF Clone, Canine, N-HA tag DG70085-NY
    IL12RB2 cDNA ORF Clone, Canine, C-Myc tag DG70085-CM
    IL12RB2 cDNA ORF Clone, Canine, N-Myc tag DG70085-NM

    IL12RB2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL12RB2 cDNA ORF Clone in Cloning Vector, Rat RG80185-G
    IL12RB2 cDNA ORF Clone, Rat, untagged RG80185-UT
    IL12RB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80185-ACGLN
    IL12RB2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80185-ACG
    IL12RB2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80185-ACR
    IL12RB2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80185-CF
    IL12RB2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80185-NF
    IL12RB2 cDNA ORF Clone, Rat, C-His tag RG80185-CH
    IL12RB2 cDNA ORF Clone, Rat, N-His tag RG80185-NH
    IL12RB2 cDNA ORF Clone, Rat, C-HA tag RG80185-CY
    IL12RB2 cDNA ORF Clone, Rat, N-HA tag RG80185-NY
    IL12RB2 cDNA ORF Clone, Rat, C-Myc tag RG80185-CM
    IL12RB2 cDNA ORF Clone, Rat, N-Myc tag RG80185-NM
    IL12RB2 qPCR Primer Pairs, Rat RP300177

    IL12RB2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL12RB2 cDNA ORF Clone in Cloning Vector, Mouse MG50099-M
    IL12RB2 cDNA ORF Clone, Mouse, untagged MG50099-UT
    IL12RB2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50099-ACGLN
    IL12RB2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50099-ACG
    IL12RB2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50099-ACR
    IL12RB2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50099-CF
    IL12RB2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50099-NF
    IL12RB2 cDNA ORF Clone, Mouse, C-His tag MG50099-CH
    IL12RB2 cDNA ORF Clone, Mouse, N-His tag MG50099-NH
    IL12RB2 cDNA ORF Clone, Mouse, C-HA tag MG50099-CY
    IL12RB2 cDNA ORF Clone, Mouse, N-HA tag MG50099-NY
    IL12RB2 cDNA ORF Clone, Mouse, C-Myc tag MG50099-CM
    IL12RB2 cDNA ORF Clone, Mouse, N-Myc tag MG50099-NM
    IL12RB2 qPCR Primer Pairs, Mouse MP200129

    IL12RB2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL12RB2 cDNA ORF Clone in Cloning Vector, Human HG10145-M
    IL12RB2 cDNA ORF Clone, Human, untagged HG10145-UT
    IL12RB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10145-ACG
    IL12RB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10145-ACGLN
    IL12RB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10145-ACR
    IL12RB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10145-CF
    IL12RB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10145-NF
    IL12RB2 cDNA ORF Clone, Human, C-His tag HG10145-CH
    IL12RB2 cDNA ORF Clone, Human, N-His tag HG10145-NH
    IL12RB2 cDNA ORF Clone, Human, C-HA tag HG10145-CY
    IL12RB2 cDNA ORF Clone, Human, N-HA tag HG10145-NY
    IL12RB2 cDNA ORF Clone, Human, C-Myc tag HG10145-CM
    IL12RB2 qPCR Primer Pairs, Human HP100216
    info info
    添加购物车成功! 添加购物车失败!