Iduronate 2 sulfatase cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10337-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Iduronate 2 sulfatase Reagents
CRO Services
Product recommended

All Iduronate 2 sulfatase Reagents
Iduronate 2 sulfatase cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1653 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human iduronate 2-sulfatase, transcript variant 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.69kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Iduronate 2 sulfatase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Iduronate 2 sulfatase cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Iduronate 2 sulfatase cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
IDS cDNA ORF Clone, Human;MPS2 cDNA ORF Clone, Human;SIDS cDNA ORF Clone, Human
Iduronate 2 sulfatase Background Information

Iduronate 2-Sulfatase, also known as IDS, is a member of the highly conserved sulfatase family of enzymes that catalyze the hydrolysis of O- and N-sulfate esters from a variety of substrates. The human Iduronate 2-Sulfatase/IDS consists of a signal peptide, a pro peptide and a mature chain that may be further processed into two chains. Among the identified 18 human sulfatases, Iduronate 2-Sulfatase/IDS is required for the lysosomal degradation of the glycosaminoglycans (GAG), heparan sulfate and dermatan sulfate. Multiple mutations in this X-chromosome localized gene result in Iduronate 2-Sulfatase/IDS enzymatic deficiency, and lead to the sex-linked Mucopolysaccharidosis Type II (MPS II ), also known as Hunter Syndrome characterized by the lysosomal accumulation of the GAG and their excretion in urine. MPS II has a wide spectrum of clinical manifestations ranging from mild to severe due to the level of Iduronate 2-Sulfatase/IDS enzyme. Retroviral-mediated Iduronate 2-Sulfatase/IDS gene transfer into lymphoid cells would be a promising gene therapeutic strategy.

Full Name
iduronate 2-sulfatase
References
  • Wilson P.J., et al.,(1990), Hunter syndrome: isolation of an iduronate-2-sulfatase cDNA clone and analysis of patient DNA. Proc. Natl. Acad. Sci. U.S.A. 87:8531-8535.
  • Wilson P.J., et al., (1993), Sequence of the human iduronate 2-sulfatase (IDS) gene.Genomics 17:773-775.
  • Timms K.M., et al.,(1995), 130 kb of DNA sequence reveals two new genes and a regional duplication distal to the human iduronate-2-sulfate sulfatase locus.Genome Res. 5:71-78.
  • Iduronate 2 sulfatase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, untagged MG5A7294-UT
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7294-ACG
    Iduronate 2 sulfatase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7294-ACGLN
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7294-ACR
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7294-CF
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7294-NF
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, C-His tag MG5A7294-CH
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, N-His tag MG5A7294-NH
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, C-HA tag MG5A7294-CY
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, N-HA tag MG5A7294-NY
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, C-Myc tag MG5A7294-CM
    Iduronate 2 sulfatase cDNA ORF Clone, Mouse, N-Myc tag MG5A7294-NM

    Iduronate 2 sulfatase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Iduronate 2 sulfatase cDNA ORF Clone in Cloning Vector, Human HG10337-M
    Iduronate 2 sulfatase cDNA ORF Clone, Human, untagged HG10337-UT
    Iduronate 2 sulfatase cDNA ORF Clone, Human, C-GFPSpark® tag HG10337-ACG
    Iduronate 2 sulfatase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10337-ACGLN
    Iduronate 2 sulfatase cDNA ORF Clone, Human, C-OFPSpark® tag HG10337-ACR
    Iduronate 2 sulfatase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10337-NF
    Iduronate 2 sulfatase cDNA ORF Clone, Human, C-His tag HG10337-CH
    Iduronate 2 sulfatase cDNA ORF Clone, Human, N-His tag HG10337-NH
    Iduronate 2 sulfatase cDNA ORF Clone, Human, C-HA tag HG10337-CY
    Iduronate 2 sulfatase cDNA ORF Clone, Human, N-HA tag HG10337-NY
    Iduronate 2 sulfatase cDNA ORF Clone, Human, C-Myc tag HG10337-CM
    Iduronate 2 sulfatase cDNA ORF Clone, Human, N-Myc tag HG10337-NM
    Iduronate 2 sulfatase qPCR Primer Pairs, Human HP100105
    info info
    添加购物车成功! 添加购物车失败!