HYAL2 cDNA ORF Clone, Human, N-His tag

Cat: HG14275-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HYAL2 Reagents
CRO Services
Product recommended

All HYAL2 Reagents
HYAL2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1422 bp
Description
Full length Clone DNA of Human hyaluronoglucosaminidase 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HYAL2 cDNA ORF Clone, Human, N-His tag Alternative Names
LUCA2 cDNA ORF Clone, Human
HYAL2 Background Information
Full Name
hyaluronoglucosaminidase 2

HYAL2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
HYAL2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90704-G
HYAL2 cDNA ORF Clone, Cynomolgus, untagged CG90704-UT
HYAL2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90704-ACG
HYAL2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90704-ACGLN
HYAL2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90704-ACR
HYAL2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90704-CF
HYAL2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90704-NF
HYAL2 cDNA ORF Clone, Cynomolgus, C-His tag CG90704-CH
HYAL2 cDNA ORF Clone, Cynomolgus, N-His tag CG90704-NH
HYAL2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90704-CY
HYAL2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90704-NY
HYAL2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90704-CM
HYAL2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90704-NM

HYAL2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HYAL2 cDNA ORF Clone in Cloning Vector, Rat RG81646-G
HYAL2 cDNA ORF Clone, Rat, untagged RG81646-UT
HYAL2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81646-ACG
HYAL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81646-ACGLN
HYAL2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81646-ACR
HYAL2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81646-CF
HYAL2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81646-NF
HYAL2 cDNA ORF Clone, Rat, C-His tag RG81646-CH
HYAL2 cDNA ORF Clone, Rat, N-His tag RG81646-NH
HYAL2 cDNA ORF Clone, Rat, C-HA tag RG81646-CY
HYAL2 cDNA ORF Clone, Rat, N-HA tag RG81646-NY
HYAL2 cDNA ORF Clone, Rat, C-Myc tag RG81646-CM
HYAL2 cDNA ORF Clone, Rat, N-Myc tag RG81646-NM

HYAL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HYAL2 cDNA ORF Clone in Cloning Vector, Human HG14275-G
HYAL2 cDNA ORF Clone, Human, untagged HG14275-UT
HYAL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14275-ACGLN
HYAL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14275-ACG
HYAL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14275-ACR
HYAL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14275-CF
HYAL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14275-NF
HYAL2 cDNA ORF Clone, Human, C-His tag HG14275-CH
HYAL2 cDNA ORF Clone, Human, C-HA tag HG14275-CY
HYAL2 cDNA ORF Clone, Human, N-HA tag HG14275-NY
HYAL2 cDNA ORF Clone, Human, C-Myc tag HG14275-CM
HYAL2 cDNA ORF Clone, Human, N-Myc tag HG14275-NM
HYAL2 qPCR Primer Pairs, Human HP102925
info info
添加购物车成功! 添加购物车失败!