Hsp90 alpha cDNA ORF Clone, Human, N-Myc tag

Cat: HG11445-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Hsp90 alpha Reagents
CRO Services
Product recommended

All Hsp90 alpha Reagents
Hsp90 alpha cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2199 bp
Description
Full length Clone DNA of Human heat shock protein 90kDa alpha (cytosolic), class A member 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Hsp90 alpha cDNA ORF Clone, Human, N-Myc tag Alternative Names
EL52 cDNA ORF Clone, Human;HSP86 cDNA ORF Clone, Human;Hsp89 cDNA ORF Clone, Human;HSP89A cDNA ORF Clone, Human;Hsp90 cDNA ORF Clone, Human;HSP90A cDNA ORF Clone, Human;HSP90N cDNA ORF Clone, Human;HSPC1 cDNA ORF Clone, Human;HSPCA cDNA ORF Clone, Human;HSPCAL1 cDNA ORF Clone, Human;HSPCAL4 cDNA ORF Clone, Human;HSPN cDNA ORF Clone, Human;LAP-2 cDNA ORF Clone, Human;LAP2 cDNA ORF Clone, Human
Hsp90 alpha Background Information

Heat shock protein 90 (90 kDa heat-shock protein, HSP90) is a molecular chaperone involved in the trafficking of proteins in the cell. It is a remarkably versatile protein involved in the stress response and in normal homoeostatic control mechanisms. HSP90 interacts with 'client proteins', including protein kinases, transcription factors and others, and either facilitates their stabilization and activation or directs them for proteasomal degradation. By this means, HSP90 displays a multifaceted ability to influence signal transduction, chromatin remodelling and epigenetic regulation, development and morphological evolution. HSP90 operates as a dimer in a conformational cycle driven by ATP binding and hydrolysis at the N-terminus. Disruption of HSP90 leads to client protein degradation and often cell death. Under stressful conditions, HSP90 stabilizes its client proteins and provides protection to the cell against cellular stressors such as in cancer cells. Especially, several oncoproteins act as HSP90 client proteins and tumor cells require higher HSP90 activity than normal cells to maintain their malignancy. For this reason, Hsp90 has emerged as a promising target for anti-cancer drug development.

Full Name
heat shock protein 90kDa alpha (cytosolic), class A member 1
References
  • Pearl LH, et al. (2008) The Hsp90 molecular chaperone: an open and shut case for treatment. Biochem J. 410(3): 439-53.
  • Hahn JS. (2009) The Hsp90 chaperone machinery: from structure to drug development. BMB Rep. 42(10): 623-30.
  • Holzbeierlein JM, et al. (2010) Hsp90: a drug target? Curr Oncol Rep. 12(2): 95-101.
  • Trepel J, et al. (2010) Targeting the dynamic HSP90 complex in cancer. Nat Rev Cancer. 10(8): 537-49.
  • Hsp90 alpha cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Hsp90 alpha cDNA ORF Clone in Cloning Vector, Rhesus CG90401-G
    Hsp90 alpha cDNA ORF Clone, Rhesus, untagged CG90401-UT
    Hsp90 alpha cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90401-ACG
    Hsp90 alpha Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90401-ACGLN
    Hsp90 alpha cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90401-ANG
    Hsp90 alpha cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90401-ACR
    Hsp90 alpha cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90401-ANR
    Hsp90 alpha cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90401-CF
    Hsp90 alpha cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90401-NF
    Hsp90 alpha cDNA ORF Clone, Rhesus, C-His tag CG90401-CH
    Hsp90 alpha cDNA ORF Clone, Rhesus, N-His tag CG90401-NH
    Hsp90 alpha cDNA ORF Clone, Rhesus, C-HA tag CG90401-CY
    Hsp90 alpha cDNA ORF Clone, Rhesus, N-HA tag CG90401-NY
    Hsp90 alpha cDNA ORF Clone, Rhesus, C-Myc tag CG90401-CM
    Hsp90 alpha cDNA ORF Clone, Rhesus, N-Myc tag CG90401-NM

    Hsp90 alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Hsp90 alpha cDNA ORF Clone in Cloning Vector, Mouse MG51995-G
    Hsp90 alpha cDNA ORF Clone, Mouse, untagged MG51995-UT
    Hsp90 alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51995-ACG
    Hsp90 alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51995-ACGLN
    Hsp90 alpha cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51995-ANG
    Hsp90 alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51995-ACR
    Hsp90 alpha cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51995-ANR
    Hsp90 alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51995-CF
    Hsp90 alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51995-NF
    Hsp90 alpha cDNA ORF Clone, Mouse, C-His tag MG51995-CH
    Hsp90 alpha cDNA ORF Clone, Mouse, N-His tag MG51995-NH
    Hsp90 alpha cDNA ORF Clone, Mouse, C-HA tag MG51995-CY
    Hsp90 alpha cDNA ORF Clone, Mouse, N-HA tag MG51995-NY
    Hsp90 alpha cDNA ORF Clone, Mouse, C-Myc tag MG51995-CM
    Hsp90 alpha cDNA ORF Clone, Mouse, N-Myc tag MG51995-NM
    Hsp90 alpha qPCR Primer Pairs, Mouse MP201868

    Hsp90 alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Hsp90 alpha cDNA ORF Clone in Cloning Vector, Human HG11445-G
    Hsp90 alpha cDNA ORF Clone, Human, untagged HG11445-UT
    Hsp90 alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11445-ACGLN
    Hsp90 alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG11445-ACG
    Hsp90 alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG11445-ANG
    Hsp90 alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG11445-ACR
    Hsp90 alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG11445-ANR
    Hsp90 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11445-CF
    Hsp90 alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11445-NF
    Hsp90 alpha cDNA ORF Clone, Human, C-His tag HG11445-CH
    Hsp90 alpha cDNA ORF Clone, Human, N-His tag HG11445-NH
    Hsp90 alpha cDNA ORF Clone, Human, C-HA tag HG11445-CY
    Hsp90 alpha cDNA ORF Clone, Human, N-HA tag HG11445-NY
    Hsp90 alpha cDNA ORF Clone, Human, C-Myc tag HG11445-CM
    Hsp90 alpha qPCR Primer Pairs, Human HP101322
    info info
    添加购物车成功! 添加购物车失败!