HPRT1 cDNA ORF Clone, Human, C-His tag

Cat: HG12034-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HPRT1 Reagents
CRO Services
Product recommended

All HPRT1 Reagents
HPRT1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Human hypoxanthine phosphoribosyltransferase 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HPRT1 cDNA ORF Clone, Human, C-His tag Alternative Names
HGPRT cDNA ORF Clone, Human;HPRT cDNA ORF Clone, Human
HPRT1 Background Information
Full Name
hypoxanthine phosphoribosyltransferase 1

HPRT1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
HPRT1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90498-G
HPRT1 cDNA ORF Clone, Cynomolgus, untagged CG90498-UT
HPRT1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90498-ACGLN
HPRT1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90498-ACG
HPRT1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90498-ANG
HPRT1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90498-ACR
HPRT1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90498-ANR
HPRT1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90498-CF
HPRT1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90498-NF
HPRT1 cDNA ORF Clone, Cynomolgus, C-His tag CG90498-CH
HPRT1 cDNA ORF Clone, Cynomolgus, N-His tag CG90498-NH
HPRT1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90498-CY
HPRT1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90498-NY
HPRT1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90498-CM
HPRT1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90498-NM

HPRT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HPRT1 cDNA ORF Clone in Cloning Vector, Rat RG80842-U
HPRT1 cDNA ORF Clone, Rat, untagged RG80842-UT
HPRT1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80842-ACGLN
HPRT1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80842-ACG
HPRT1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80842-ANG
HPRT1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80842-ACR
HPRT1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80842-ANR
HPRT1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80842-CF
HPRT1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80842-NF
HPRT1 cDNA ORF Clone, Rat, C-His tag RG80842-CH
HPRT1 cDNA ORF Clone, Rat, N-His tag RG80842-NH
HPRT1 cDNA ORF Clone, Rat, C-HA tag RG80842-CY
HPRT1 cDNA ORF Clone, Rat, N-HA tag RG80842-NY
HPRT1 cDNA ORF Clone, Rat, C-Myc tag RG80842-CM
HPRT1 cDNA ORF Clone, Rat, N-Myc tag RG80842-NM
HPRT1 qPCR Primer Pairs, Rat RP300806

HPRT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HPRT1 cDNA ORF Clone in Cloning Vector, Human HG12034-G
HPRT1 cDNA ORF Clone, Human, untagged HG12034-UT
HPRT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12034-ACGLN
HPRT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12034-ACG
HPRT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12034-ANG
HPRT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12034-ACR
HPRT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12034-ANR
HPRT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12034-CF
HPRT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12034-NF
HPRT1 cDNA ORF Clone, Human, N-His tag HG12034-NH
HPRT1 cDNA ORF Clone, Human, C-HA tag HG12034-CY
HPRT1 cDNA ORF Clone, Human, N-HA tag HG12034-NY
HPRT1 cDNA ORF Clone, Human, C-Myc tag HG12034-CM
HPRT1 cDNA ORF Clone, Human, N-Myc tag HG12034-NM
HPRT1 qPCR Primer Pairs, Human HP100005
info info
添加购物车成功! 添加购物车失败!