HEXA cDNA ORF Clone, Human, untagged

Cat: HG12037-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HEXA Reagents
CRO Services
Product recommended

All HEXA Reagents
HEXA cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1590 bp
Description
Full length Clone DNA of Human hexosaminidase A (alpha polypeptide).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HEXA cDNA ORF Clone, Human, untagged Alternative Names
TSD cDNA ORF Clone, Human
HEXA Background Information
Full Name
hexosaminidase A (alpha polypeptide)
References
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • HEXA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HEXA cDNA ORF Clone in Cloning Vector, Mouse MG53109-G
    HEXA cDNA ORF Clone, Mouse, untagged MG53109-UT
    HEXA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53109-ACGLN
    HEXA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53109-ACG
    HEXA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53109-ACR
    HEXA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53109-CF
    HEXA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53109-NF
    HEXA cDNA ORF Clone, Mouse, C-His tag MG53109-CH
    HEXA cDNA ORF Clone, Mouse, N-His tag MG53109-NH
    HEXA cDNA ORF Clone, Mouse, C-HA tag MG53109-CY
    HEXA cDNA ORF Clone, Mouse, N-HA tag MG53109-NY
    HEXA cDNA ORF Clone, Mouse, C-Myc tag MG53109-CM
    HEXA cDNA ORF Clone, Mouse, N-Myc tag MG53109-NM

    HEXA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HEXA cDNA ORF Clone in Cloning Vector, Human HG12037-G
    HEXA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12037-ACGLN
    HEXA cDNA ORF Clone, Human, C-GFPSpark® tag HG12037-ACG
    HEXA cDNA ORF Clone, Human, C-OFPSpark® tag HG12037-ACR
    HEXA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12037-CF
    HEXA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12037-NF
    HEXA cDNA ORF Clone, Human, C-His tag HG12037-CH
    HEXA cDNA ORF Clone, Human, N-His tag HG12037-NH
    HEXA cDNA ORF Clone, Human, C-HA tag HG12037-CY
    HEXA cDNA ORF Clone, Human, N-HA tag HG12037-NY
    HEXA cDNA ORF Clone, Human, C-Myc tag HG12037-CM
    HEXA cDNA ORF Clone, Human, N-Myc tag HG12037-NM
    HEXA qPCR Primer Pairs, Human HP101571
    info info
    添加购物车成功! 添加购物车失败!