Granzyme B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13352-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Granzyme B Reagents
CRO Services
Product recommended

All Granzyme B Reagents
Granzyme B cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Human granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Granzyme B cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CCPI cDNA ORF Clone, Human;CGL-1 cDNA ORF Clone, Human;CGL1 cDNA ORF Clone, Human;CSP-B cDNA ORF Clone, Human;CSPB cDNA ORF Clone, Human;CTLA1 cDNA ORF Clone, Human;CTSGL1 cDNA ORF Clone, Human;HLP cDNA ORF Clone, Human;SECT cDNA ORF Clone, Human
Granzyme B Background Information

Granzyme B, also known as GZMB, is the most prominent member of the granzyme family of cell death-inducing serine proteases expressed in the granules of cytotoxic T lymphocytes (CTLs) and NK cells. Granzyme B enters the target cells depending on another membrane-binding granule protein, perforin, results in the activation of effector caspases and mitochondrial depolarization through caspase-dependent and -independent pathways, and consequently induces rapid cell apoptosis. Over 30 substrates of GZMB have been identified including the key substrate caspase-3, ICAD and Bid. GZMB is suggested to protect the host by lysing cells bearing on their surface 'nonself' antigens such as bacterial and viral infected-cells and tumor cells, and accordingly plays an essential role in immunosurveillance.

Full Name
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
References
  • Schmid J., et al.,(1987), Induction of mRNA for a serine protease and a beta-thromboglobulin-like protein in mitogen-stimulated human leukocytes. J. Immunol. 139:250-256.
  • Caputo A., et al., (1988), Structure and differential mechanisms of regulation of expression of a serine esterase gene in activated human T lymphocytes.J. Biol. Chem. 263:6363-6369.
  • Trapani J.A., et al.,(1988), Molecular cloning of an inducible serine esterase gene from human cytotoxic lymphocytes.Proc. Natl. Acad. Sci. U.S.A. 85:6924-6928.
  • Granzyme B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Granzyme B cDNA ORF Clone in Cloning Vector, Mouse MG50914-G
    Granzyme B cDNA ORF Clone, Mouse, untagged MG50914-UT
    Granzyme B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50914-ACGLN
    Granzyme B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50914-ACG
    Granzyme B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50914-ANG
    Granzyme B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50914-ACR
    Granzyme B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50914-ANR
    Granzyme B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50914-CF
    Granzyme B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50914-NF
    Granzyme B cDNA ORF Clone, Mouse, C-His tag MG50914-CH
    Granzyme B cDNA ORF Clone, Mouse, N-His tag MG50914-NH
    Granzyme B cDNA ORF Clone, Mouse, C-HA tag MG50914-CY
    Granzyme B cDNA ORF Clone, Mouse, N-HA tag MG50914-NY
    Granzyme B cDNA ORF Clone, Mouse, C-Myc tag MG50914-CM
    Granzyme B cDNA ORF Clone, Mouse, N-Myc tag MG50914-NM
    Granzyme B qPCR Primer Pairs, Mouse MP200883

    Granzyme B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Granzyme B cDNA ORF Clone in Cloning Vector, Human HG13352-G
    Granzyme B cDNA ORF Clone in Cloning Vector, Human HG10345-M
    Granzyme B cDNA ORF Clone, Human, untagged HG10345-UT
    Granzyme B cDNA ORF Clone, Human, untagged HG13352-UT
    Granzyme B cDNA ORF Clone, Human, C-GFPSpark® tag HG10345-ACG
    Granzyme B cDNA ORF Clone, Human, C-GFPSpark® tag HG13352-ACG
    Granzyme B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10345-ACGLN
    Granzyme B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13352-ACGLN
    Granzyme B cDNA ORF Clone, Human, N-GFPSpark® tag HG13352-ANG
    Granzyme B cDNA ORF Clone, Human, C-OFPSpark® tag HG13352-ACR
    Granzyme B cDNA ORF Clone, Human, C-OFPSpark® tag HG10345-ACR
    Granzyme B cDNA ORF Clone, Human, N-OFPSpark® tag HG13352-ANR
    Granzyme B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13352-CF
    Granzyme B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10345-CF
    Granzyme B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10345-NF
    Granzyme B cDNA ORF Clone, Human, C-His tag HG13352-CH
    Granzyme B cDNA ORF Clone, Human, C-His tag HG10345-CH
    Granzyme B cDNA ORF Clone, Human, N-His tag HG10345-NH
    Granzyme B cDNA ORF Clone, Human, N-His tag HG13352-NH
    Granzyme B cDNA ORF Clone, Human, C-HA tag HG13352-CY
    Granzyme B cDNA ORF Clone, Human, C-HA tag HG10345-CY
    Granzyme B cDNA ORF Clone, Human, N-HA tag HG10345-NY
    Granzyme B cDNA ORF Clone, Human, N-HA tag HG13352-NY
    Granzyme B cDNA ORF Clone, Human, C-Myc tag HG10345-CM
    Granzyme B cDNA ORF Clone, Human, C-Myc tag HG13352-CM
    Granzyme B cDNA ORF Clone, Human, N-Myc tag HG10345-NM
    Granzyme B cDNA ORF Clone, Human, N-Myc tag HG13352-NM
    Granzyme B qPCR Primer Pairs, Human HP100383
    info info
    添加购物车成功! 添加购物车失败!