Glycophorin C cDNA ORF Clone, Human, C-Myc tag

Cat: HG15627-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Glycophorin C Reagents
CRO Services
Product recommended

All Glycophorin C Reagents
Glycophorin C cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Human glycophorin C (Gerbich blood group) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glycophorin C cDNA ORF Clone, Human, C-Myc tag Alternative Names
CD236 cDNA ORF Clone, Human;CD236R cDNA ORF Clone, Human;GE cDNA ORF Clone, Human;GPC cDNA ORF Clone, Human;GPD cDNA ORF Clone, Human;GYPD cDNA ORF Clone, Human;PAS-2 cDNA ORF Clone, Human;PAS-2' cDNA ORF Clone, Human
Glycophorin C Background Information
Full Name
glycophorin C (Gerbich blood group)

Glycophorin C cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Glycophorin C cDNA ORF Clone in Cloning Vector, Rat RG80373-G
Glycophorin C cDNA ORF Clone, Rat, untagged RG80373-UT
Glycophorin C Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80373-ACGLN
Glycophorin C cDNA ORF Clone, Rat, C-GFPSpark® tag RG80373-ACG
Glycophorin C cDNA ORF Clone, Rat, C-OFPSpark® tag RG80373-ACR
Glycophorin C cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80373-CF
Glycophorin C cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80373-NF
Glycophorin C cDNA ORF Clone, Rat, C-His tag RG80373-CH
Glycophorin C cDNA ORF Clone, Rat, N-His tag RG80373-NH
Glycophorin C cDNA ORF Clone, Rat, C-HA tag RG80373-CY
Glycophorin C cDNA ORF Clone, Rat, N-HA tag RG80373-NY
Glycophorin C cDNA ORF Clone, Rat, C-Myc tag RG80373-CM
Glycophorin C cDNA ORF Clone, Rat, N-Myc tag RG80373-NM
Glycophorin C qPCR Primer Pairs, Rat RP300340

Glycophorin C cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Glycophorin C cDNA ORF Clone in Cloning Vector, Mouse MG5A7530-U
Glycophorin C cDNA ORF Clone, Mouse, untagged MG5A7530-UT
Glycophorin C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7530-ACG
Glycophorin C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7530-ACGLN
Glycophorin C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7530-ACR
Glycophorin C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7530-CF
Glycophorin C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7530-NF
Glycophorin C cDNA ORF Clone, Mouse, C-His tag MG5A7530-CH
Glycophorin C cDNA ORF Clone, Mouse, N-His tag MG5A7530-NH
Glycophorin C cDNA ORF Clone, Mouse, C-HA tag MG5A7530-CY
Glycophorin C cDNA ORF Clone, Mouse, N-HA tag MG5A7530-NY
Glycophorin C cDNA ORF Clone, Mouse, C-Myc tag MG5A7530-CM
Glycophorin C cDNA ORF Clone, Mouse, N-Myc tag MG5A7530-NM

Glycophorin C cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Glycophorin C cDNA ORF Clone in Cloning Vector, Human HG15627-G
Glycophorin C cDNA ORF Clone, Human, untagged HG15627-UT
Glycophorin C cDNA ORF Clone, Human, C-GFPSpark® tag HG15627-ACG
Glycophorin C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15627-ACGLN
Glycophorin C cDNA ORF Clone, Human, C-OFPSpark® tag HG15627-ACR
Glycophorin C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15627-CF
Glycophorin C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15627-NF
Glycophorin C cDNA ORF Clone, Human, C-His tag HG15627-CH
Glycophorin C cDNA ORF Clone, Human, N-His tag HG15627-NH
Glycophorin C cDNA ORF Clone, Human, C-HA tag HG15627-CY
Glycophorin C cDNA ORF Clone, Human, N-HA tag HG15627-NY
Glycophorin C cDNA ORF Clone, Human, N-Myc tag HG15627-NM
Glycophorin C qPCR Primer Pairs, Human HP104245
info info
添加购物车成功! 添加购物车失败!