GTF3C2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16283-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GTF3C2 Reagents
CRO Services
Product recommended

All GTF3C2 Reagents
GTF3C2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2736 bp
Description
Full length Clone DNA of Human general transcription factor IIIC, polypeptide 2, beta 110kDa with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GTF3C2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
TFIIIC-BETA cDNA ORF Clone, Human;TFIIIC110 cDNA ORF Clone, Human
GTF3C2 Background Information
Full Name
general transcription factor IIIC, polypeptide 2, beta 110kDa

GTF3C2 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
GTF3C2 cDNA ORF Clone in Cloning Vector, Rabbit TG65142-G
GTF3C2 cDNA ORF Clone, Rabbit, untagged TG65142-UT
GTF3C2 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65142-ACG
GTF3C2 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65142-ACGLN
GTF3C2 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65142-ANG
GTF3C2 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65142-ACR
GTF3C2 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65142-ANR
GTF3C2 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65142-CF
GTF3C2 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65142-NF
GTF3C2 cDNA ORF Clone, Rabbit, C-His tag TG65142-CH
GTF3C2 cDNA ORF Clone, Rabbit, N-His tag TG65142-NH
GTF3C2 cDNA ORF Clone, Rabbit, C-HA tag TG65142-CY
GTF3C2 cDNA ORF Clone, Rabbit, N-HA tag TG65142-NY
GTF3C2 cDNA ORF Clone, Rabbit, C-Myc tag TG65142-CM
GTF3C2 cDNA ORF Clone, Rabbit, N-Myc tag TG65142-NM

GTF3C2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GTF3C2 cDNA ORF Clone in Cloning Vector, Human HG16283-G
GTF3C2 cDNA ORF Clone, Human, untagged HG16283-UT
GTF3C2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16283-ACG
GTF3C2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16283-ACGLN
GTF3C2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16283-ANG
GTF3C2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16283-ACR
GTF3C2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16283-ANR
GTF3C2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16283-NF
GTF3C2 cDNA ORF Clone, Human, C-His tag HG16283-CH
GTF3C2 cDNA ORF Clone, Human, N-His tag HG16283-NH
GTF3C2 cDNA ORF Clone, Human, C-HA tag HG16283-CY
GTF3C2 cDNA ORF Clone, Human, N-HA tag HG16283-NY
GTF3C2 cDNA ORF Clone, Human, C-Myc tag HG16283-CM
GTF3C2 cDNA ORF Clone, Human, N-Myc tag HG16283-NM
GTF3C2 qPCR Primer Pairs, Human HP105037
info info
添加购物车成功! 添加购物车失败!