GNG2 cDNA ORF Clone, Human, C-HA tag

Cat: HG14062-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GNG2 Reagents
CRO Services
Product recommended

All GNG2 Reagents
GNG2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
216 bp
Description
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), gamma 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNG2 Background Information
Full Name
guanine nucleotide binding protein (G protein), gamma 2

GNG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GNG2 cDNA ORF Clone in Cloning Vector, Rat RG86056-U
GNG2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86056-ACGLN

GNG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GNG2 cDNA ORF Clone in Cloning Vector, Mouse MG53748-U
GNG2 cDNA ORF Clone, Mouse, untagged MG53748-UT
GNG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53748-ACG
GNG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53748-ACGLN
GNG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53748-ACR
GNG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53748-CF
GNG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53748-NF
GNG2 cDNA ORF Clone, Mouse, C-His tag MG53748-CH
GNG2 cDNA ORF Clone, Mouse, N-His tag MG53748-NH
GNG2 cDNA ORF Clone, Mouse, C-HA tag MG53748-CY
GNG2 cDNA ORF Clone, Mouse, N-HA tag MG53748-NY
GNG2 cDNA ORF Clone, Mouse, C-Myc tag MG53748-CM
GNG2 cDNA ORF Clone, Mouse, N-Myc tag MG53748-NM

GNG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GNG2 cDNA ORF Clone in Cloning Vector, Human HG14062-G
GNG2 cDNA ORF Clone, Human, untagged HG14062-UT
GNG2 cDNA ORF Clone, Human, untagged HG14062-G-N
GNG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14062-ACG
GNG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14062-ACGLN
GNG2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14062-ANG
GNG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14062-ACR
GNG2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14062-ANR
GNG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14062-CF
GNG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14062-NF
GNG2 cDNA ORF Clone, Human, C-His tag HG14062-CH
GNG2 cDNA ORF Clone, Human, N-His tag HG14062-NH
GNG2 cDNA ORF Clone, Human, N-HA tag HG14062-NY
GNG2 cDNA ORF Clone, Human, C-Myc tag HG14062-CM
GNG2 cDNA ORF Clone, Human, N-Myc tag HG14062-NM
GNG2 qPCR Primer Pairs, Human HP102718
info info
添加购物车成功! 添加购物车失败!