GALK1 cDNA ORF Clone, Human, N-His tag

Cat: HG11383-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GALK1 Reagents
CRO Services
Product recommended

All GALK1 Reagents
GALK1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1179 bp
Description
Full length Clone DNA of Human galactokinase 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GALK1 cDNA ORF Clone, Human, N-His tag Alternative Names
GALK cDNA ORF Clone, Human;GK1 cDNA ORF Clone, Human;HEL-S-19 cDNA ORF Clone, Human
GALK1 Background Information

Galactokinase, also known as Galactose kinase, GALK and GALK1, is a protein which belongs to the GHMP kinase family and GalK subfamily. Galactokinase / GALK1 is a major enzyme for galactose metabolism. Galactokinase (GALK) deficiency is an autosomal recessive disorder characterized by elevation of blood galactose concentration and diminished galactose-1-phosphate, leading to the production of galactitol. Defects in GALK1 are the cause of galactosemia II ( GALCT2 ) which II is an autosomal recessive deficiency characterized by congenital cataracts during infancy and presenile cataracts in the adult population. The cataracts are secondary to accumulation of galactitol in the lenses.

Full Name
galactokinase 1
References
  • Hunter,M. et al., 2001, Hum Mutat. 17 (1):77-8.
  • Park,H.D. et al., 2007, Mol Genet Metab. 91 (3):234-8.
  • Park,H.D. et al., 2009, BMC Med Genet. 10 :29.
  • GALK1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GALK1 cDNA ORF Clone in Cloning Vector, Rat RG84696-U
    GALK1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84696-ACGLN

    GALK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GALK1 cDNA ORF Clone in Cloning Vector, Mouse MG59021-U
    GALK1 cDNA ORF Clone, Mouse, untagged MG59021-UT
    GALK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59021-ACG
    GALK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59021-ACGLN
    GALK1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59021-ANG
    GALK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59021-ACR
    GALK1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59021-ANR
    GALK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59021-CF
    GALK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59021-NF
    GALK1 cDNA ORF Clone, Mouse, C-His tag MG59021-CH
    GALK1 cDNA ORF Clone, Mouse, N-His tag MG59021-NH
    GALK1 cDNA ORF Clone, Mouse, C-HA tag MG59021-CY
    GALK1 cDNA ORF Clone, Mouse, N-HA tag MG59021-NY
    GALK1 cDNA ORF Clone, Mouse, C-Myc tag MG59021-CM
    GALK1 cDNA ORF Clone, Mouse, N-Myc tag MG59021-NM

    GALK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GALK1 cDNA ORF Clone in Cloning Vector, Human HG11383-M
    GALK1 cDNA ORF Clone, Human, untagged HG11383-UT
    GALK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11383-ACG
    GALK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11383-ACGLN
    GALK1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11383-ANG
    GALK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11383-ACR
    GALK1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11383-ANR
    GALK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11383-CF
    GALK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11383-NF
    GALK1 cDNA ORF Clone, Human, C-His tag HG11383-CH
    GALK1 cDNA ORF Clone, Human, C-HA tag HG11383-CY
    GALK1 cDNA ORF Clone, Human, N-HA tag HG11383-NY
    GALK1 cDNA ORF Clone, Human, C-Myc tag HG11383-CM
    GALK1 cDNA ORF Clone, Human, N-Myc tag HG11383-NM
    GALK1 qPCR Primer Pairs, Human HP101262
    info info
    添加购物车成功! 添加购物车失败!