FKBP10 cDNA ORF Clone, Human, C-His tag

Cat: HG13404-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FKBP10 Reagents
CRO Services
Product recommended

All FKBP10 Reagents
FKBP10 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1749 bp
Description
Full length Clone DNA of Human FK506 binding protein 10, 65 kDa with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FKBP10 cDNA ORF Clone, Human, C-His tag Alternative Names
BRKS1 cDNA ORF Clone, Human;FKBP65 cDNA ORF Clone, Human;hFKBP65 cDNA ORF Clone, Human;OI11 cDNA ORF Clone, Human;OI6 cDNA ORF Clone, Human;PPIASE cDNA ORF Clone, Human
FKBP10 Background Information
Full Name
FK506 binding protein 10, 65 kDa

FKBP10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FKBP10 cDNA ORF Clone in Cloning Vector, Rat RG80932-U
FKBP10 cDNA ORF Clone, Rat, untagged RG80932-UT
FKBP10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80932-ACG
FKBP10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80932-ACGLN
FKBP10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80932-ACR
FKBP10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80932-CF
FKBP10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80932-NF
FKBP10 cDNA ORF Clone, Rat, C-His tag RG80932-CH
FKBP10 cDNA ORF Clone, Rat, N-His tag RG80932-NH
FKBP10 cDNA ORF Clone, Rat, C-HA tag RG80932-CY
FKBP10 cDNA ORF Clone, Rat, N-HA tag RG80932-NY
FKBP10 cDNA ORF Clone, Rat, C-Myc tag RG80932-CM
FKBP10 cDNA ORF Clone, Rat, N-Myc tag RG80932-NM
FKBP10 qPCR Primer Pairs, Rat RP300896

FKBP10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FKBP10 cDNA ORF Clone in Cloning Vector, Mouse MG5A1953-U
FKBP10 cDNA ORF Clone, Mouse, untagged MG5A1953-UT
FKBP10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1953-ACGLN
FKBP10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1953-ACG
FKBP10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1953-ACR
FKBP10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1953-CF
FKBP10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1953-NF
FKBP10 cDNA ORF Clone, Mouse, C-His tag MG5A1953-CH
FKBP10 cDNA ORF Clone, Mouse, N-His tag MG5A1953-NH
FKBP10 cDNA ORF Clone, Mouse, C-HA tag MG5A1953-CY
FKBP10 cDNA ORF Clone, Mouse, N-HA tag MG5A1953-NY
FKBP10 cDNA ORF Clone, Mouse, C-Myc tag MG5A1953-CM
FKBP10 cDNA ORF Clone, Mouse, N-Myc tag MG5A1953-NM

FKBP10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FKBP10 cDNA ORF Clone in Cloning Vector, Human HG13404-G
FKBP10 cDNA ORF Clone, Human, untagged HG13404-UT
FKBP10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13404-ACGLN
FKBP10 cDNA ORF Clone, Human, C-GFPSpark® tag HG13404-ACG
FKBP10 cDNA ORF Clone, Human, C-OFPSpark® tag HG13404-ACR
FKBP10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13404-CF
FKBP10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13404-NF
FKBP10 cDNA ORF Clone, Human, N-His tag HG13404-NH
FKBP10 cDNA ORF Clone, Human, C-HA tag HG13404-CY
FKBP10 cDNA ORF Clone, Human, N-HA tag HG13404-NY
FKBP10 cDNA ORF Clone, Human, C-Myc tag HG13404-CM
FKBP10 cDNA ORF Clone, Human, N-Myc tag HG13404-NM
FKBP10 qPCR Primer Pairs, Human HP102107
info info
添加购物车成功! 添加购物车失败!