FGL2 cDNA ORF Clone, Human, untagged

Cat: HG11200-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FGL2 Reagents
CRO Services
Product recommended

All FGL2 Reagents
FGL2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1320 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibrinogen-like 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + XbaI (6.1kb + 1.32kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FGL2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGL2 cDNA ORF Clone, Human, untagged Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624
FGL2 cDNA ORF Clone, Human, untagged Alternative Names
pT49 cDNA ORF Clone, Human;T49 cDNA ORF Clone, Human
FGL2 Background Information
Full Name
fibrinogen-like 2

FGL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FGL2 cDNA ORF Clone in Cloning Vector, Mouse MG50536-M
FGL2 cDNA ORF Clone, Mouse, untagged MG50536-UT
FGL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50536-ACGLN
FGL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50536-ACG
FGL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50536-ACR
FGL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50536-CF
FGL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50536-NF
FGL2 cDNA ORF Clone, Mouse, C-His tag MG50536-CH
FGL2 cDNA ORF Clone, Mouse, N-His tag MG50536-NH
FGL2 cDNA ORF Clone, Mouse, C-HA tag MG50536-CY
FGL2 cDNA ORF Clone, Mouse, N-HA tag MG50536-NY
FGL2 cDNA ORF Clone, Mouse, C-Myc tag MG50536-CM
FGL2 cDNA ORF Clone, Mouse, N-Myc tag MG50536-NM
FGL2 qPCR Primer Pairs, Mouse MP200528

FGL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FGL2 cDNA ORF Clone in Cloning Vector, Human HG11200-M
FGL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11200-ACGLN
FGL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11200-ACG
FGL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11200-ACR
FGL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11200-CF
FGL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11200-NF
FGL2 cDNA ORF Clone, Human, C-His tag HG11200-CH
FGL2 cDNA ORF Clone, Human, N-His tag HG11200-NH
FGL2 cDNA ORF Clone, Human, C-HA tag HG11200-CY
FGL2 cDNA ORF Clone, Human, N-HA tag HG11200-NY
FGL2 cDNA ORF Clone, Human, C-Myc tag HG11200-CM
FGL2 cDNA ORF Clone, Human, N-Myc tag HG11200-NM
FGL2 qPCR Primer Pairs, Human HP101105
info info
添加购物车成功! 添加购物车失败!