FAP cDNA ORF Clone, Human, C-His tag

Cat: HG10464-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FAP Reagents
CRO Services
Product recommended

All FAP Reagents
FAP cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2283 bp
Description
Full length Clone DNA of Human fibroblast activation protein, alpha with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAP cDNA ORF Clone, Human, C-His tag Alternative Names
DPPIV cDNA ORF Clone, Human;DPPIVA cDNA ORF Clone, Human;FAPA cDNA ORF Clone, Human;Fibroblast Activation Protein alpha cDNA ORF Clone, Human;SIMP cDNA ORF Clone, Human
FAP Background Information

Seprase, also known as 170 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane serine protease and FAP, is a single-pass type II membrane protein which belongs to the peptidase S9B family. Seprase / FAP is found in cell surface lamellipodia, invadopodia and on shed vesicles. Seprase / FAP appears to act as a proteolytically active 170-kDa dimer, consisting of two 97-kDa subunits. It is a member of the group type II integral serine proteases, which includes dipeptidyl peptidase IV ( DPPIV / CD26 ) and related type II transmembrane prolyl serine peptidases, which exert their mechanisms of action on the cell surface. Seprase / FAP colocalized with DPP4 in invadopodia and lamellipodia of migratory activated endothelial cells in collagenous matrix. Seprase / FAP colocalized with DPP4 on endothelial cells of capillary-like microvessels but not large vessels within invasive breast ductal carcinoma. DPP4 and seprase exhibit multiple functions due to their abilities to form complexes with each other and to interact with other membrane-associated molecules. In association with DPP4, Seprase / FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. Seprase / FAP has a dual function in tumour progression. The proteolytic activity of Seprase has been shown to promote cell invasiveness towards the ECM and also to support tumour growth and proliferation. Seprase / FAP may have a role in tissue remodeling during development and wound healing, and may contribute to invasiveness in malignant cancers.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
fibroblast activation protein, alpha
Research Areas
References
  • Mori,Y. et al., 2004, Oncology. 67 (5-6):411-9.
  • Aertgeerts K., et al., 2005, J. Biol. Chem. 280:19441-19444.
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-2080.
  • Ghersi G., et al., 2006, Cancer Res. 66:4652-4661.
  • O'Brien,P. et al., 2008, Biochim Biophys Acta. 1784 (9):1130-45.
  • FAP cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    FAP cDNA ORF Clone in Cloning Vector, Cynomolgus CG90879-G

    FAP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FAP cDNA ORF Clone in Cloning Vector, Mouse MG50996-G
    FAP cDNA ORF Clone, Mouse, untagged MG50996-UT
    FAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50996-ACGLN
    FAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50996-ACG
    FAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50996-ACR
    FAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50996-CF
    FAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50996-NF
    FAP cDNA ORF Clone, Mouse, C-His tag MG50996-CH
    FAP cDNA ORF Clone, Mouse, N-His tag MG50996-NH
    FAP cDNA ORF Clone, Mouse, C-HA tag MG50996-CY
    FAP cDNA ORF Clone, Mouse, N-HA tag MG50996-NY
    FAP cDNA ORF Clone, Mouse, C-Myc tag MG50996-CM
    FAP cDNA ORF Clone, Mouse, N-Myc tag MG50996-NM
    FAP qPCR Primer Pairs, Mouse MP200961

    FAP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FAP cDNA ORF Clone in Cloning Vector, Human HG10464-M
    FAP cDNA ORF Clone, Human, untagged HG10464-UT
    FAP cDNA ORF Clone, Human, C-GFPSpark® tag HG10464-ACG
    FAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10464-ACGLN
    FAP cDNA ORF Clone, Human, C-OFPSpark® tag HG10464-ACR
    FAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10464-CF
    FAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10464-NF
    FAP cDNA ORF Clone, Human, N-His tag HG10464-NH
    FAP cDNA ORF Clone, Human, C-HA tag HG10464-CY
    FAP cDNA ORF Clone, Human, N-HA tag HG10464-NY
    FAP cDNA ORF Clone, Human, C-Myc tag HG10464-CM
    FAP cDNA ORF Clone, Human, N-Myc tag HG10464-NM
    FAP qPCR Primer Pairs, Human HP101274
    info info
    添加购物车成功! 添加购物车失败!