Thrombin Receptor cDNA ORF Clone, Human, C-Myc tag

Cat: HG13535-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Thrombin Receptor Reagents
CRO Services
Product recommended

All Thrombin Receptor Reagents
Thrombin Receptor cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1278 bp
Description
Full length Clone DNA of Human coagulation factor II (thrombin) receptor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thrombin Receptor cDNA ORF Clone, Human, C-Myc tag Alternative Names
CF2R cDNA ORF Clone, Human;HTR cDNA ORF Clone, Human;PAR-1 cDNA ORF Clone, Human;PAR1 cDNA ORF Clone, Human;TR cDNA ORF Clone, Human
Thrombin Receptor Background Information
Full Name
coagulation factor II (thrombin) receptor

Thrombin Receptor cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Thrombin Receptor cDNA ORF Clone in Cloning Vector, Rat RG81891-U
Thrombin Receptor Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81891-ACGLN

Thrombin Receptor cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Thrombin Receptor cDNA ORF Clone in Cloning Vector, Mouse MG57338-U
Thrombin Receptor cDNA ORF Clone, Mouse, untagged MG57338-UT
Thrombin Receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57338-ACG
Thrombin Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57338-ACGLN
Thrombin Receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57338-ACR
Thrombin Receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57338-CF
Thrombin Receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57338-NF
Thrombin Receptor cDNA ORF Clone, Mouse, C-His tag MG57338-CH
Thrombin Receptor cDNA ORF Clone, Mouse, N-His tag MG57338-NH
Thrombin Receptor cDNA ORF Clone, Mouse, C-HA tag MG57338-CY
Thrombin Receptor cDNA ORF Clone, Mouse, N-HA tag MG57338-NY
Thrombin Receptor cDNA ORF Clone, Mouse, C-Myc tag MG57338-CM
Thrombin Receptor cDNA ORF Clone, Mouse, N-Myc tag MG57338-NM

Thrombin Receptor cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Thrombin Receptor cDNA ORF Clone in Cloning Vector, Human HG13535-G
Thrombin Receptor cDNA ORF Clone, Human, untagged HG13535-UT
Thrombin Receptor cDNA ORF Clone, Human, C-GFPSpark® tag HG13535-ACG
Thrombin Receptor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13535-ACGLN
Thrombin Receptor cDNA ORF Clone, Human, C-OFPSpark® tag HG13535-ACR
Thrombin Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13535-CF
Thrombin Receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13535-NF
Thrombin Receptor cDNA ORF Clone, Human, C-His tag HG13535-CH
Thrombin Receptor cDNA ORF Clone, Human, N-His tag HG13535-NH
Thrombin Receptor cDNA ORF Clone, Human, C-HA tag HG13535-CY
Thrombin Receptor cDNA ORF Clone, Human, N-HA tag HG13535-NY
Thrombin Receptor cDNA ORF Clone, Human, N-Myc tag HG13535-NM
Thrombin Receptor qPCR Primer Pairs, Human HP102221
info info
添加购物车成功! 添加购物车失败!