Ephrin A4 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12087-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Ephrin A4 Reagents
CRO Services
Product recommended

All Ephrin A4 Reagents
Ephrin A4 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
606 bp
Description
Full length Clone DNA of Human ephrin-A4 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin A4 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
EFL4 cDNA ORF Clone, Human;EPLG4 cDNA ORF Clone, Human;LERK4 cDNA ORF Clone, Human
Ephrin A4 Background Information

EPH-related receptor tyrosine kinase ligand 4 (Ephrin-A4) also known as EFNA4, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Eph/ephrin interactions are implicated in axon guidance, neural crest cell migration, establishment of segmental boundaries, and formation of angiogenic capillary plexi. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A4/EFNA4 functions as a cell surface GPI-bound ligand for Eph receptor, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development.

Full Name
ephrin-A4
References
  • Aasheim HC, et al. (2000) A splice variant of human ephrin-A4 encodes a soluble molecule that is secreted by activated human B lymphocytes. Blood. 95(1): 221-30.
  • Moss A, et al. (2005) Ephrin-A4 inhibits sensory neurite outgrowth and is regulated by neonatal skin wounding. Eur J Neurosci. 22(10): 2413-21.
  • Cerretti DP, et al. (1998) Characterization of the genes for mouse LERK-3/Ephrin-A3 (Epl3), mouse LERK-4/Ephrin-A4 (Epl4), and human LERK-6/Ephrin-A2 (EPLG6): conservation of intron/exon structure. Genomics. 47(1): 131-5.
  • Ephrin A4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ephrin A4 cDNA ORF Clone in Cloning Vector, Mouse MG50595-M
    Ephrin A4 cDNA ORF Clone, Mouse, untagged MG50595-UT
    Ephrin A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50595-ACGLN
    Ephrin A4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50595-ACG
    Ephrin A4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50595-ACR
    Ephrin A4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50595-CF
    Ephrin A4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50595-NF
    Ephrin A4 cDNA ORF Clone, Mouse, C-His tag MG50595-CH
    Ephrin A4 cDNA ORF Clone, Mouse, N-His tag MG50595-NH
    Ephrin A4 cDNA ORF Clone, Mouse, C-HA tag MG50595-CY
    Ephrin A4 cDNA ORF Clone, Mouse, N-HA tag MG50595-NY
    Ephrin A4 cDNA ORF Clone, Mouse, C-Myc tag MG50595-CM
    Ephrin A4 cDNA ORF Clone, Mouse, N-Myc tag MG50595-NM
    Ephrin A4 qPCR Primer Pairs, Mouse MP200580

    Ephrin A4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ephrin A4 cDNA ORF Clone in Cloning Vector, Human HG12087-G
    Ephrin A4 cDNA ORF Clone, Human, untagged HG12087-UT
    Ephrin A4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12087-ACGLN
    Ephrin A4 cDNA ORF Clone, Human, C-GFPSpark® tag HG12087-ACG
    Ephrin A4 cDNA ORF Clone, Human, C-OFPSpark® tag HG12087-ACR
    Ephrin A4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12087-CF
    Ephrin A4 cDNA ORF Clone, Human, C-His tag HG12087-CH
    Ephrin A4 cDNA ORF Clone, Human, N-His tag HG12087-NH
    Ephrin A4 cDNA ORF Clone, Human, C-HA tag HG12087-CY
    Ephrin A4 cDNA ORF Clone, Human, N-HA tag HG12087-NY
    Ephrin A4 cDNA ORF Clone, Human, C-Myc tag HG12087-CM
    Ephrin A4 cDNA ORF Clone, Human, N-Myc tag HG12087-NM
    Ephrin A4 qPCR Primer Pairs, Human HP101615
    info info
    添加购物车成功! 添加购物车失败!