EEF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13966-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All EEF2 Reagents

CRO Services

Product recommended


All EEF2 Reagents

EEF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2577 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation elongation factor 2 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + XbaI (6kb + 2.62kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EEF2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EEF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Human 4E-BP1/EIF4EBP1 Gene Plasmid Map 5648

EEF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

EEF-2 cDNA ORF Clone, Human;EF-2 cDNA ORF Clone, Human;EF2 cDNA ORF Clone, Human;SCA26 cDNA ORF Clone, Human

EEF2 Background Information

Full Name
eukaryotic translation elongation factor 2

EEF2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EEF2 cDNA ORF Clone in Cloning Vector, Rat RG81613-G
EEF2 cDNA ORF Clone, Rat, untagged RG81613-UT
EEF2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81613-ACGLN
EEF2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81613-ACG
EEF2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81613-ANG
EEF2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81613-ACR
EEF2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81613-ANR
EEF2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81613-CF
EEF2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81613-NF
EEF2 cDNA ORF Clone, Rat, C-His tag RG81613-CH
EEF2 cDNA ORF Clone, Rat, N-His tag RG81613-NH
EEF2 cDNA ORF Clone, Rat, C-HA tag RG81613-CY
EEF2 cDNA ORF Clone, Rat, N-HA tag RG81613-NY
EEF2 cDNA ORF Clone, Rat, C-Myc tag RG81613-CM
EEF2 cDNA ORF Clone, Rat, N-Myc tag RG81613-NM

EEF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EEF2 cDNA ORF Clone in Cloning Vector, Mouse MG51203-U
EEF2 cDNA ORF Clone, Mouse, untagged MG51203-UT
EEF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51203-ACGLN
EEF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51203-ACG
EEF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51203-ANG
EEF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51203-ACR
EEF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51203-ANR
EEF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51203-CF
EEF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51203-NF
EEF2 cDNA ORF Clone, Mouse, C-His tag MG51203-CH
EEF2 cDNA ORF Clone, Mouse, N-His tag MG51203-NH
EEF2 cDNA ORF Clone, Mouse, C-HA tag MG51203-CY
EEF2 cDNA ORF Clone, Mouse, N-HA tag MG51203-NY
EEF2 cDNA ORF Clone, Mouse, C-Myc tag MG51203-CM
EEF2 cDNA ORF Clone, Mouse, N-Myc tag MG51203-NM
EEF2 qPCR Primer Pairs, Mouse MP201087

EEF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EEF2 cDNA ORF Clone in Cloning Vector, Human HG13966-G
EEF2 cDNA ORF Clone, Human, untagged HG13966-UT
EEF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13966-ACGLN
EEF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13966-ACG
EEF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13966-ANG
EEF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13966-ACR
EEF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13966-ANR
EEF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13966-CF
EEF2 cDNA ORF Clone, Human, C-His tag HG13966-CH
EEF2 cDNA ORF Clone, Human, N-His tag HG13966-NH
EEF2 cDNA ORF Clone, Human, C-HA tag HG13966-CY
EEF2 cDNA ORF Clone, Human, N-HA tag HG13966-NY
EEF2 cDNA ORF Clone, Human, C-Myc tag HG13966-CM
EEF2 cDNA ORF Clone, Human, N-Myc tag HG13966-NM
EEF2 qPCR Primer Pairs, Human HP102624
info info
添加购物车成功! 添加购物车失败!