DCXR cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14562-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DCXR Reagents
CRO Services
Product recommended

All DCXR Reagents
DCXR cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human dicarbonyl/L-xylulose reductase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCXR cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
DCR cDNA ORF Clone, Human;HCR2 cDNA ORF Clone, Human;HCRII cDNA ORF Clone, Human;KIDCR cDNA ORF Clone, Human;P34H cDNA ORF Clone, Human;PNTSU cDNA ORF Clone, Human;SDR20C1 cDNA ORF Clone, Human;XR cDNA ORF Clone, Human
DCXR Background Information

DCXR, also known as HCR2, belongs to the short-chain dehydrogenases/reductases (SDR) family. It is highly expressed in kidney, liver and epididymis. In the epididymis, DCXR is mainly expressed in the proximal and distal sections of the corpus region. HCR2 is weakly or not expressed in brain, lung, heart, spleen and testis. DCXR catalyzes the NADPH-dependent reduction of several pentoses, tetroses, trioses, alpha-dicarbonyl compounds and L-xylulose. DCXR participates in the uronate cycle of glucose metabolism. It may play a role in the water absorption and cellular osmoregulation in the proximal renal tubules by producing xylitol, an osmolyte, thereby preventing osmolytic stress from occurring in the renal tubules.

Full Name
dicarbonyl/L-xylulose reductase
References
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Pierce SB, et al. (2011) Garrod's fourth inborn error of metabolism solved by the identification of mutations causing pentosuria. Proc Natl Acad Sci. 108(45):18313-7.
  • Udeshi ND, et al. (2012) Methods for quantification of in vivo changes in protein ubiquitination following proteasome and deubiquitinase inhibition. Mol Cell Proteomics. 11(5):148-59.
  • info info
    添加购物车成功! 添加购物车失败!