DCTN6 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15662-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DCTN6 Reagents
CRO Services
Product recommended

All DCTN6 Reagents
DCTN6 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
573 bp
Description
Full length Clone DNA of Human dynactin 6 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCTN6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
p27 cDNA ORF Clone, Human;WS-3 cDNA ORF Clone, Human;WS3 cDNA ORF Clone, Human
DCTN6 Background Information
Full Name
dynactin 6

DCTN6 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
DCTN6 cDNA ORF Clone in Cloning Vector, Canine DG70126-U

DCTN6 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
DCTN6 cDNA ORF Clone in Cloning Vector, Rhesus CG90625-G
DCTN6 cDNA ORF Clone, Rhesus, untagged CG90625-UT
DCTN6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90625-ACG
DCTN6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90625-ACGLN
DCTN6 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90625-ANG
DCTN6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90625-ACR
DCTN6 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90625-ANR
DCTN6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90625-CF
DCTN6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90625-NF
DCTN6 cDNA ORF Clone, Rhesus, C-His tag CG90625-CH
DCTN6 cDNA ORF Clone, Rhesus, N-His tag CG90625-NH
DCTN6 cDNA ORF Clone, Rhesus, C-HA tag CG90625-CY
DCTN6 cDNA ORF Clone, Rhesus, N-HA tag CG90625-NY
DCTN6 cDNA ORF Clone, Rhesus, C-Myc tag CG90625-CM
DCTN6 cDNA ORF Clone, Rhesus, N-Myc tag CG90625-NM

DCTN6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DCTN6 cDNA ORF Clone in Cloning Vector, Rat RG8A4030-U
DCTN6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4030-ACGLN

DCTN6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCTN6 cDNA ORF Clone in Cloning Vector, Mouse MG5A4612-U
DCTN6 cDNA ORF Clone, Mouse, untagged MG5A4612-UT
DCTN6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4612-ACG
DCTN6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4612-ACGLN
DCTN6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4612-ANG
DCTN6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4612-ACR
DCTN6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4612-ANR
DCTN6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4612-CF
DCTN6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4612-NF
DCTN6 cDNA ORF Clone, Mouse, C-His tag MG5A4612-CH
DCTN6 cDNA ORF Clone, Mouse, N-His tag MG5A4612-NH
DCTN6 cDNA ORF Clone, Mouse, C-HA tag MG5A4612-CY
DCTN6 cDNA ORF Clone, Mouse, N-HA tag MG5A4612-NY
DCTN6 cDNA ORF Clone, Mouse, C-Myc tag MG5A4612-CM
DCTN6 cDNA ORF Clone, Mouse, N-Myc tag MG5A4612-NM

DCTN6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCTN6 cDNA ORF Clone in Cloning Vector, Human HG15662-G
DCTN6 cDNA ORF Clone, Human, untagged HG15662-UT
DCTN6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15662-ACGLN
DCTN6 cDNA ORF Clone, Human, C-GFPSpark® tag HG15662-ACG
DCTN6 cDNA ORF Clone, Human, N-GFPSpark® tag HG15662-ANG
DCTN6 cDNA ORF Clone, Human, C-OFPSpark® tag HG15662-ACR
DCTN6 cDNA ORF Clone, Human, N-OFPSpark® tag HG15662-ANR
DCTN6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15662-NF
DCTN6 cDNA ORF Clone, Human, C-His tag HG15662-CH
DCTN6 cDNA ORF Clone, Human, N-His tag HG15662-NH
DCTN6 cDNA ORF Clone, Human, C-HA tag HG15662-CY
DCTN6 cDNA ORF Clone, Human, N-HA tag HG15662-NY
DCTN6 cDNA ORF Clone, Human, C-Myc tag HG15662-CM
DCTN6 cDNA ORF Clone, Human, N-Myc tag HG15662-NM
DCTN6 qPCR Primer Pairs, Human HP104277
info info
添加购物车成功! 添加购物车失败!