CAR cDNA ORF Clone, Human, N-Myc tag

Cat: HG10799-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CAR Reagents
CRO Services
Product recommended

All CAR Reagents
CAR cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1098 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human coxsackie virus and adenovirus receptor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
KpnI + XbaI (6kb + 1.13kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CAR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CAR cDNA ORF Clone, Human, N-Myc tag Validated Images
Ferret CD3e/CD3 epsilon Gene Plasmid Map 5630
CAR cDNA ORF Clone, Human, N-Myc tag Alternative Names
CAR cDNA ORF Clone, Human;CAR4/6 cDNA ORF Clone, Human;CXADR cDNA ORF Clone, Human;HCAR cDNA ORF Clone, Human
CAR Background Information

CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I  transmembrane glycoprotein belonging to the CTX family of the Ig superfamily, and is essential for normal cardiac development in the mouse. Proposed as a homophilic cell adhesion molecule, CXADR is a component of the epithelial apical junction complex that is essential for the tight junction integrity, and probably involved in transepithelial migration of polymorphonuclear leukocytes (PMN). Mature mouse CXADR structrually comprises a 218 aa extracellular domain (ECD) with a V-type (D1) and a C2-type (D2) Ig-like domain, a 21 aa transmembrane segment and a 107 aa intracellular domain, among which,D1 is thought to be responsible for homodimer formation in trans within tight junctions. The ECD of mouse CXADR shares 97%, 90% sequence identity with the corresponding regions of rat, human CXADR.

Full Name
coxsackie virus and adenovirus receptor
References
  • Tomko, R.P. et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94 (7): 3352–3356.
  • van Raaij , M.J. et al., 2001, Structure. 8 (11): 1147–1155.
  • Cohen, C.J. et al., 2001, J. Biol. Chem. 276 (27): 25392–25398.
  • Carson, S.D. et al., 2002, Rev. Med. Virol. 11 (4): 219–226.
  • Selinka, H.C. et al., 2004, Med. Microbiol. Immunol. 193 (2-3): 127–131.
  • Philipson, L. et al., 2004, Curr. Top. Microbiol. Immunol. 273:87-111.
  • Raschperger, E. et al., 2006, Exp. Cell Res. 312: 1566-1580.
  • CAR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CAR cDNA ORF Clone in Cloning Vector, Mouse MG50019-M
    CAR cDNA ORF Clone, Mouse, untagged MG50019-UT
    CAR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50019-ACG
    CAR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50019-ACGLN
    CAR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50019-ACR
    CAR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50019-CF
    CAR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50019-NF
    CAR cDNA ORF Clone, Mouse, C-His tag MG50019-CH
    CAR cDNA ORF Clone, Mouse, N-His tag MG50019-NH
    CAR cDNA ORF Clone, Mouse, C-HA tag MG50019-CY
    CAR cDNA ORF Clone, Mouse, N-HA tag MG50019-NY
    CAR cDNA ORF Clone, Mouse, C-Myc tag MG50019-CM
    CAR cDNA ORF Clone, Mouse, N-Myc tag MG50019-NM
    CAR qPCR Primer Pairs, Mouse MP200019

    CAR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CAR cDNA ORF Clone in Cloning Vector, Human HG10799-M
    CAR cDNA ORF Clone, Human, untagged HG10799-UT
    CAR cDNA ORF Clone, Human, C-GFPSpark® tag HG10799-ACG
    CAR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10799-ACGLN
    CAR cDNA ORF Clone, Human, C-OFPSpark® tag HG10799-ACR
    CAR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10799-CF
    CAR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10799-NF
    CAR cDNA ORF Clone, Human, C-His tag HG10799-CH
    CAR cDNA ORF Clone, Human, N-His tag HG10799-NH
    CAR cDNA ORF Clone, Human, C-HA tag HG10799-CY
    CAR cDNA ORF Clone, Human, N-HA tag HG10799-NY
    CAR cDNA ORF Clone, Human, C-Myc tag HG10799-CM
    CAR qPCR Primer Pairs, Human HP100713
    info info
    添加购物车成功! 添加购物车失败!