alpha COP I cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16291-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All alpha COP I Reagents
CRO Services
Product recommended

All alpha COP I Reagents
alpha COP I cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3675 bp
Description
Full length Clone DNA of Human coatomer protein complex, subunit alpha with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha COP I cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
HEP-COP cDNA ORF Clone, Human
alpha COP I Background Information
Full Name
coatomer protein complex, subunit alpha

alpha COP I cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
alpha COP I cDNA ORF Clone in Cloning Vector, Mouse MG5A7601-U
alpha COP I cDNA ORF Clone, Mouse, untagged MG5A7601-UT
alpha COP I Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7601-ACGLN
alpha COP I cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7601-ACG
alpha COP I cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A7601-ANG
alpha COP I cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A7601-ACR
alpha COP I cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A7601-ANR
alpha COP I cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7601-CF
alpha COP I cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A7601-NF
alpha COP I cDNA ORF Clone, Mouse, C-His tag MG5A7601-CH
alpha COP I cDNA ORF Clone, Mouse, N-His tag MG5A7601-NH
alpha COP I cDNA ORF Clone, Mouse, C-HA tag MG5A7601-CY
alpha COP I cDNA ORF Clone, Mouse, N-HA tag MG5A7601-NY
alpha COP I cDNA ORF Clone, Mouse, C-Myc tag MG5A7601-CM
alpha COP I cDNA ORF Clone, Mouse, N-Myc tag MG5A7601-NM

alpha COP I cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
alpha COP I cDNA ORF Clone in Cloning Vector, Human HG16291-G
alpha COP I cDNA ORF Clone, Human, untagged HG16291-UT
alpha COP I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29690-ACGLN
alpha COP I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16291-ACGLN
alpha COP I cDNA ORF Clone, Human, C-GFPSpark® tag HG16291-ACG
alpha COP I cDNA ORF Clone, Human, N-GFPSpark® tag HG16291-ANG
alpha COP I cDNA ORF Clone, Human, C-OFPSpark® tag HG16291-ACR
alpha COP I cDNA ORF Clone, Human, N-OFPSpark® tag HG16291-ANR
alpha COP I cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16291-NF
alpha COP I cDNA ORF Clone, Human, C-His tag HG16291-CH
alpha COP I cDNA ORF Clone, Human, N-His tag HG16291-NH
alpha COP I cDNA ORF Clone, Human, C-HA tag HG16291-CY
alpha COP I cDNA ORF Clone, Human, N-HA tag HG16291-NY
alpha COP I cDNA ORF Clone, Human, C-Myc tag HG16291-CM
alpha COP I cDNA ORF Clone, Human, N-Myc tag HG16291-NM
alpha COP I qPCR Primer Pairs, Human HP105045
info info
添加购物车成功! 添加购物车失败!