CISD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14432-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CISD2 Reagents
CRO Services
Product recommended

All CISD2 Reagents
CISD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
408 bp
Description
Full length Clone DNA of Human CDGSH iron sulfur domain 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CISD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ERIS cDNA ORF Clone, Human;Miner1 cDNA ORF Clone, Human;NAF-1 cDNA ORF Clone, Human;WFS2 cDNA ORF Clone, Human;ZCD2 cDNA ORF Clone, Human
CISD2 Background Information
Full Name
CDGSH iron sulfur domain 2

CISD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CISD2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1170-U
CISD2 cDNA ORF Clone, Mouse, untagged MG5A1170-UT
CISD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1170-ACGLN
CISD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1170-ACG
CISD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1170-ANG
CISD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1170-ACR
CISD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1170-ANR
CISD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1170-CF
CISD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1170-NF
CISD2 cDNA ORF Clone, Mouse, C-His tag MG5A1170-CH
CISD2 cDNA ORF Clone, Mouse, N-His tag MG5A1170-NH
CISD2 cDNA ORF Clone, Mouse, C-HA tag MG5A1170-CY
CISD2 cDNA ORF Clone, Mouse, N-HA tag MG5A1170-NY
CISD2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1170-CM
CISD2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1170-NM

CISD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CISD2 cDNA ORF Clone in Cloning Vector, Human HG14432-G
CISD2 cDNA ORF Clone, Human, untagged HG14432-UT
CISD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14432-ACG
CISD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14432-ACGLN
CISD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14432-ACR
CISD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14432-NF
CISD2 cDNA ORF Clone, Human, C-His tag HG14432-CH
CISD2 cDNA ORF Clone, Human, N-His tag HG14432-NH
CISD2 cDNA ORF Clone, Human, C-HA tag HG14432-CY
CISD2 cDNA ORF Clone, Human, N-HA tag HG14432-NY
CISD2 cDNA ORF Clone, Human, C-Myc tag HG14432-CM
CISD2 cDNA ORF Clone, Human, N-Myc tag HG14432-NM
CISD2 qPCR Primer Pairs, Human HP103080
info info
添加购物车成功! 添加购物车失败!