CHST12 cDNA ORF Clone, Human, N-His tag

Cat: HG12308-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHST12 Reagents
CRO Services
Product recommended

All CHST12 Reagents
CHST12 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Human carbohydrate (chondroitin 4) sulfotransferase 12 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHST12 cDNA ORF Clone, Human, N-His tag Alternative Names
C4S-2 cDNA ORF Clone, Human;C4ST-2 cDNA ORF Clone, Human;C4ST2 cDNA ORF Clone, Human
CHST12 Background Information
Full Name
carbohydrate (chondroitin 4) sulfotransferase 12

CHST12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHST12 cDNA ORF Clone in Cloning Vector, Mouse MG53301-U
CHST12 cDNA ORF Clone, Mouse, untagged MG53301-UT
CHST12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53301-ACG
CHST12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53301-ACGLN
CHST12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53301-ACR
CHST12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53301-CF
CHST12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53301-NF
CHST12 cDNA ORF Clone, Mouse, C-His tag MG53301-CH
CHST12 cDNA ORF Clone, Mouse, N-His tag MG53301-NH
CHST12 cDNA ORF Clone, Mouse, C-HA tag MG53301-CY
CHST12 cDNA ORF Clone, Mouse, N-HA tag MG53301-NY
CHST12 cDNA ORF Clone, Mouse, C-Myc tag MG53301-CM
CHST12 cDNA ORF Clone, Mouse, N-Myc tag MG53301-NM

CHST12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHST12 cDNA ORF Clone in Cloning Vector, Human HG12308-G
CHST12 cDNA ORF Clone, Human, untagged HG12308-UT
CHST12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12308-ACGLN
CHST12 cDNA ORF Clone, Human, C-GFPSpark® tag HG12308-ACG
CHST12 cDNA ORF Clone, Human, C-OFPSpark® tag HG12308-ACR
CHST12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12308-CF
CHST12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12308-NF
CHST12 cDNA ORF Clone, Human, C-His tag HG12308-CH
CHST12 cDNA ORF Clone, Human, C-HA tag HG12308-CY
CHST12 cDNA ORF Clone, Human, N-HA tag HG12308-NY
CHST12 cDNA ORF Clone, Human, C-Myc tag HG12308-CM
CHST12 cDNA ORF Clone, Human, N-Myc tag HG12308-NM
CHST12 qPCR Primer Pairs, Human HP101940
info info
添加购物车成功! 添加购物车失败!