CGB7 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13120-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CGB7 Reagents
CRO Services

All CGB7 Reagents
CGB7 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
498 bp
Description
Full length Clone DNA of Human chorionic gonadotropin, beta polypeptide 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About CGB7
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CGB7 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CG-beta-a cDNA ORF Clone, Human;CGB6 cDNA ORF Clone, Human
CGB7 Background Information

CGB7 (chorionic gonadotropin, beta polypeptide 7) belongs to the glycoprotein hormones subunit beta family. Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CGB7 gene is a member of the glycoprotein hormone beta chain family and encodes the beta 7 subunit of chorionic gonadotropin (CG). CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. CGB7 is used as adjunctive therapy in the treatment of obesity. CGB7 also stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy.

Full Name
chorionic gonadotropin beta subunit 7
References
  • Fiddes J.C., et al.,(1980), The cDNA for the beta-subunit of human chorionic gonadotropin suggests evolution of a gene by readthrough into the 3'-untranslated region. Nature 286:684-687.
  • Talmadge K., et al., (1984), Evolution of the genes for the beta subunits of human chorionic gonadotropin and luteinizing hormone.Nature 307:37-40.
  • Policastro P., et al.,(1983), The beta subunit of human chorionic gonadotropin is encoded by multiple genes.J. Biol. Chem. 258:11492-11499.
  • CGB7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CGB7 cDNA ORF Clone, Human, untagged HG20470-UT
    CGB7 qPCR Primer Pairs, Human HP101741
    info info
    添加购物车成功! 添加购物车失败!